ID: 1114107661

View in Genome Browser
Species Human (GRCh38)
Location 14:19442523-19442545
Sequence CCTGATATCCAGAAGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114107661_1114107663 -8 Left 1114107661 14:19442523-19442545 CCATCAAACTTCTGGATATCAGG No data
Right 1114107663 14:19442538-19442560 ATATCAGGTCACTTCCAGCAAGG No data
1114107661_1114107668 23 Left 1114107661 14:19442523-19442545 CCATCAAACTTCTGGATATCAGG No data
Right 1114107668 14:19442569-19442591 CCTGAAGGACATTAAGTTAAAGG No data
1114107661_1114107664 -5 Left 1114107661 14:19442523-19442545 CCATCAAACTTCTGGATATCAGG No data
Right 1114107664 14:19442541-19442563 TCAGGTCACTTCCAGCAAGGTGG No data
1114107661_1114107666 8 Left 1114107661 14:19442523-19442545 CCATCAAACTTCTGGATATCAGG No data
Right 1114107666 14:19442554-19442576 AGCAAGGTGGAGAAACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114107661 Original CRISPR CCTGATATCCAGAAGTTTGA TGG (reversed) Intergenic
No off target data available for this crispr