ID: 1114109840

View in Genome Browser
Species Human (GRCh38)
Location 14:19466820-19466842
Sequence CCTTCCCAGGGTGACTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114109840_1114109846 5 Left 1114109840 14:19466820-19466842 CCACAAAAGTCACCCTGGGAAGG No data
Right 1114109846 14:19466848-19466870 TCTGTCCAATACAGTGTTCAGGG No data
1114109840_1114109845 4 Left 1114109840 14:19466820-19466842 CCACAAAAGTCACCCTGGGAAGG No data
Right 1114109845 14:19466847-19466869 GTCTGTCCAATACAGTGTTCAGG No data
1114109840_1114109848 11 Left 1114109840 14:19466820-19466842 CCACAAAAGTCACCCTGGGAAGG No data
Right 1114109848 14:19466854-19466876 CAATACAGTGTTCAGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114109840 Original CRISPR CCTTCCCAGGGTGACTTTTG TGG (reversed) Intergenic
No off target data available for this crispr