ID: 1114110418

View in Genome Browser
Species Human (GRCh38)
Location 14:19472432-19472454
Sequence AAGTATTTGAGTTTACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114110418_1114110423 19 Left 1114110418 14:19472432-19472454 CCCAGAAGTAAACTCAAATACTT No data
Right 1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG No data
1114110418_1114110424 20 Left 1114110418 14:19472432-19472454 CCCAGAAGTAAACTCAAATACTT No data
Right 1114110424 14:19472475-19472497 AAAGCAAACAATATAAAGTGGGG No data
1114110418_1114110422 18 Left 1114110418 14:19472432-19472454 CCCAGAAGTAAACTCAAATACTT No data
Right 1114110422 14:19472473-19472495 ACAAAGCAAACAATATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114110418 Original CRISPR AAGTATTTGAGTTTACTTCT GGG (reversed) Intergenic
No off target data available for this crispr