ID: 1114110421

View in Genome Browser
Species Human (GRCh38)
Location 14:19472459-19472481
Sequence TTGCTTTGTCAAAGACCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4367
Summary {0: 22, 1: 424, 2: 708, 3: 1108, 4: 2105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114110421_1114110422 -9 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110422 14:19472473-19472495 ACAAAGCAAACAATATAAAGTGG No data
1114110421_1114110424 -7 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110424 14:19472475-19472497 AAAGCAAACAATATAAAGTGGGG No data
1114110421_1114110425 18 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110425 14:19472500-19472522 AGAACACCCTACTCAACATATGG No data
1114110421_1114110428 25 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110428 14:19472507-19472529 CCTACTCAACATATGGTGCTTGG No data
1114110421_1114110423 -8 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114110421 Original CRISPR TTGCTTTGTCAAAGACCAGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr