ID: 1114110423

View in Genome Browser
Species Human (GRCh38)
Location 14:19472474-19472496
Sequence CAAAGCAAACAATATAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114110421_1114110423 -8 Left 1114110421 14:19472459-19472481 CCAACTGGTCTTTGACAAAGCAA 0: 22
1: 424
2: 708
3: 1108
4: 2105
Right 1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG No data
1114110418_1114110423 19 Left 1114110418 14:19472432-19472454 CCCAGAAGTAAACTCAAATACTT No data
Right 1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG No data
1114110419_1114110423 18 Left 1114110419 14:19472433-19472455 CCAGAAGTAAACTCAAATACTTA No data
Right 1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114110423 Original CRISPR CAAAGCAAACAATATAAAGT GGG Intergenic
No off target data available for this crispr