ID: 1114112903

View in Genome Browser
Species Human (GRCh38)
Location 14:19489021-19489043
Sequence GTGGTGCATCGACCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114112903_1114112912 20 Left 1114112903 14:19489021-19489043 CCTTCCTCAGGTCGATGCACCAC No data
Right 1114112912 14:19489064-19489086 GCAGCTCCCGGACAAGCACTAGG No data
1114112903_1114112906 -5 Left 1114112903 14:19489021-19489043 CCTTCCTCAGGTCGATGCACCAC No data
Right 1114112906 14:19489039-19489061 ACCACCGCGTGACCTCCAGGCGG No data
1114112903_1114112910 8 Left 1114112903 14:19489021-19489043 CCTTCCTCAGGTCGATGCACCAC No data
Right 1114112910 14:19489052-19489074 CTCCAGGCGGCTGCAGCTCCCGG No data
1114112903_1114112905 -8 Left 1114112903 14:19489021-19489043 CCTTCCTCAGGTCGATGCACCAC No data
Right 1114112905 14:19489036-19489058 TGCACCACCGCGTGACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114112903 Original CRISPR GTGGTGCATCGACCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr