ID: 1114115327

View in Genome Browser
Species Human (GRCh38)
Location 14:19616265-19616287
Sequence TCATGTTGATGCATGCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114115327_1114115332 2 Left 1114115327 14:19616265-19616287 CCTACAGGCATGCATCAACATGA No data
Right 1114115332 14:19616290-19616312 GGCTTCCTTTGTGCCCTTGGGGG No data
1114115327_1114115330 0 Left 1114115327 14:19616265-19616287 CCTACAGGCATGCATCAACATGA No data
Right 1114115330 14:19616288-19616310 CTGGCTTCCTTTGTGCCCTTGGG No data
1114115327_1114115336 24 Left 1114115327 14:19616265-19616287 CCTACAGGCATGCATCAACATGA No data
Right 1114115336 14:19616312-19616334 GAGTGTGCCTCCAGCAGAGAAGG No data
1114115327_1114115329 -1 Left 1114115327 14:19616265-19616287 CCTACAGGCATGCATCAACATGA No data
Right 1114115329 14:19616287-19616309 ACTGGCTTCCTTTGTGCCCTTGG No data
1114115327_1114115331 1 Left 1114115327 14:19616265-19616287 CCTACAGGCATGCATCAACATGA No data
Right 1114115331 14:19616289-19616311 TGGCTTCCTTTGTGCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114115327 Original CRISPR TCATGTTGATGCATGCCTGT AGG (reversed) Intergenic