ID: 1114116676

View in Genome Browser
Species Human (GRCh38)
Location 14:19629435-19629457
Sequence CCATCCAGGAAAACACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114116676_1114116680 -2 Left 1114116676 14:19629435-19629457 CCAGCCAGTGTTTTCCTGGATGG No data
Right 1114116680 14:19629456-19629478 GGCAAGCAAAACGTCAAGCTTGG No data
1114116676_1114116681 6 Left 1114116676 14:19629435-19629457 CCAGCCAGTGTTTTCCTGGATGG No data
Right 1114116681 14:19629464-19629486 AAACGTCAAGCTTGGAGATTTGG No data
1114116676_1114116683 8 Left 1114116676 14:19629435-19629457 CCAGCCAGTGTTTTCCTGGATGG No data
Right 1114116683 14:19629466-19629488 ACGTCAAGCTTGGAGATTTGGGG No data
1114116676_1114116682 7 Left 1114116676 14:19629435-19629457 CCAGCCAGTGTTTTCCTGGATGG No data
Right 1114116682 14:19629465-19629487 AACGTCAAGCTTGGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114116676 Original CRISPR CCATCCAGGAAAACACTGGC TGG (reversed) Intergenic
No off target data available for this crispr