ID: 1114122558

View in Genome Browser
Species Human (GRCh38)
Location 14:19686124-19686146
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114122555_1114122558 -3 Left 1114122555 14:19686104-19686126 CCATAAGGCAGCATGGTATAGTG No data
Right 1114122558 14:19686124-19686146 GTGGTATGGCCGTCAAACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114122558 Original CRISPR GTGGTATGGCCGTCAAACTT CGG Intergenic
No off target data available for this crispr