ID: 1114123632

View in Genome Browser
Species Human (GRCh38)
Location 14:19698972-19698994
Sequence CAGTAAGATTTGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114123632_1114123636 4 Left 1114123632 14:19698972-19698994 CCCATTTCCCACAAATCTTACTG No data
Right 1114123636 14:19698999-19699021 ACTTCTCACAAAATACATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114123632 Original CRISPR CAGTAAGATTTGTGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr