ID: 1114124852

View in Genome Browser
Species Human (GRCh38)
Location 14:19713439-19713461
Sequence TGGGCATCTCTATGCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 2, 1: 5, 2: 0, 3: 6, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114124852_1114124859 19 Left 1114124852 14:19713439-19713461 CCAGTTTGGCATAGAGATGCCCA 0: 2
1: 5
2: 0
3: 6
4: 95
Right 1114124859 14:19713481-19713503 GCAAGGGACGGCAGATAGCAAGG No data
1114124852_1114124857 3 Left 1114124852 14:19713439-19713461 CCAGTTTGGCATAGAGATGCCCA 0: 2
1: 5
2: 0
3: 6
4: 95
Right 1114124857 14:19713465-19713487 ATGATATTAGGATAGAGCAAGGG 0: 3
1: 1
2: 1
3: 17
4: 213
1114124852_1114124853 -9 Left 1114124852 14:19713439-19713461 CCAGTTTGGCATAGAGATGCCCA 0: 2
1: 5
2: 0
3: 6
4: 95
Right 1114124853 14:19713453-19713475 AGATGCCCAGTCATGATATTAGG No data
1114124852_1114124858 7 Left 1114124852 14:19713439-19713461 CCAGTTTGGCATAGAGATGCCCA 0: 2
1: 5
2: 0
3: 6
4: 95
Right 1114124858 14:19713469-19713491 TATTAGGATAGAGCAAGGGACGG No data
1114124852_1114124856 2 Left 1114124852 14:19713439-19713461 CCAGTTTGGCATAGAGATGCCCA 0: 2
1: 5
2: 0
3: 6
4: 95
Right 1114124856 14:19713464-19713486 CATGATATTAGGATAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114124852 Original CRISPR TGGGCATCTCTATGCCAAAC TGG (reversed) Intergenic
901166149 1:7222941-7222963 TGGTCATTTCTGTGCCACACAGG - Intronic
904999173 1:34654792-34654814 AGGGCAACTCTATGGCACACAGG - Intergenic
908828751 1:68158511-68158533 TTGGCTTCTCTGGGCCAAACCGG + Intronic
909716653 1:78716011-78716033 TGGGCATTTCTATCTCAAAGTGG + Intergenic
910835822 1:91508967-91508989 TGTTCTTCTCTATGCTAAACTGG + Intronic
911828346 1:102517152-102517174 TAGATATCTCTATGGCAAACTGG - Intergenic
915511007 1:156387089-156387111 TGGGCAGCTCTAGCCCAGACTGG + Intergenic
917082555 1:171271605-171271627 TGGGCAACTCTGTGCCTCACTGG - Intronic
922422658 1:225470178-225470200 TGGCCATCTCCATGCCAGACAGG + Intergenic
924230594 1:241958875-241958897 TGGGCCTCTCTCTGCCCTACGGG + Intergenic
1064950702 10:20846665-20846687 AGGGCATCTCTAGGCTAAAAAGG + Intronic
1067524416 10:47029503-47029525 TGGGCATCTCAATCCCACCCTGG - Intergenic
1069797613 10:71063341-71063363 TGGCCATCTCTAGGACAAAGAGG - Intergenic
1070352542 10:75607003-75607025 TGGGCTTCACTAATCCAAACTGG - Intronic
1072196552 10:93121314-93121336 TGGGCACCTCTATGCTCACCTGG - Intergenic
1073537997 10:104295355-104295377 GGGACTTCTCTATGCCACACTGG + Intronic
1080000279 11:27340044-27340066 TTGGCATATCTATGCCAAGTGGG - Intronic
1084072094 11:66743492-66743514 TGGGCAACTCTTTGCCAGGCAGG + Intergenic
1084861606 11:72022413-72022435 TGGTCATCTAGAAGCCAAACAGG + Exonic
1090184003 11:124724401-124724423 GGGGCATCTCCATGTCATACTGG - Intergenic
1091021499 11:132104193-132104215 GGGGCATCTTTATGTCAAAGTGG + Intronic
1092259534 12:6945647-6945669 TGGGCAGCTGTTTGCCAAACAGG - Intronic
1093854888 12:24089722-24089744 TAGGAATCTCTATGGCAATCTGG - Intergenic
1094797366 12:33991302-33991324 TGAGCATCTCTATTCCAAGCTGG + Intergenic
1095110108 12:38285302-38285324 TGAGCATCTCTACTCCAAGCTGG + Intergenic
1100883413 12:99042976-99042998 TGGGTATCTATATCCCAAATGGG - Intronic
1104146306 12:126037143-126037165 TGGGTTTCACTATGCCAAGCTGG - Intergenic
1107431515 13:40344809-40344831 TTGGCCTCTCTATGCAAAATAGG + Intergenic
1114033795 14:18601572-18601594 TGGGCATCTCTGTGCCAAACTGG + Exonic
1114078587 14:19180747-19180769 TGGGCATCTCTGTGCCAAACTGG + Intergenic
1114124852 14:19713439-19713461 TGGGCATCTCTATGCCAAACTGG - Intergenic
1114298608 14:21353271-21353293 TGGGCAGTGCTCTGCCAAACTGG - Intronic
1114639431 14:24209421-24209443 TAGGCAACTCTAGGACAAACCGG + Intronic
1118685290 14:68284873-68284895 TGGGTATCTCTATACAAAGCTGG + Intronic
1120943744 14:89974474-89974496 TGAGCATCTCCATTCCAAACAGG + Intronic
1123568311 15:21574728-21574750 TGGGCATCTCTGTGCCAAACTGG - Intergenic
1123604419 15:22010050-22010072 TGGGCATCTCTGTGCCAAACTGG - Intergenic
1202976668 15_KI270727v1_random:301816-301838 TGGGCATCTCTGTGCCAAACTGG - Intergenic
1135021040 16:18963204-18963226 TGTGCACCACCATGCCAAACTGG + Intergenic
1136539424 16:30921086-30921108 TGGGCAAGTCTCTGCCAAGCTGG + Intergenic
1137853191 16:51767084-51767106 AGAGCATCTCTATCCTAAACTGG - Intergenic
1144624254 17:16836737-16836759 TGGGCTTCTCTATGCTCACCAGG - Intergenic
1144882175 17:18435982-18436004 TGGGCTTCTCTATGCTCACCAGG + Intergenic
1145150058 17:20508404-20508426 TGGGCTTCTCTATGCTCACCAGG - Intergenic
1145956587 17:28858919-28858941 TGGGCATCTTAATCCCAACCAGG - Intronic
1146633093 17:34484653-34484675 TGGGCAGCTCAAGGCCAGACTGG + Intergenic
1157098609 18:44709898-44709920 TGGTCATTTATCTGCCAAACCGG + Intronic
1164686500 19:30169636-30169658 TGGCCATCTCTCTTCCCAACAGG - Intergenic
1165897111 19:39148865-39148887 TGGACATCCACATGCCAAACGGG - Intronic
1166975797 19:46604313-46604335 TGGGCTTCTAAATGCCAACCTGG - Intronic
1167521598 19:49958984-49959006 AGGGCCTCTCAGTGCCAAACTGG - Intronic
1168721639 19:58557835-58557857 TGGGAATCTCTGAGTCAAACGGG - Intronic
925787174 2:7443666-7443688 TGGGCATCCCTCTTCCAAGCAGG + Intergenic
928816491 2:35301621-35301643 TTGGCATCTTTATGCCTAATTGG - Intergenic
931095014 2:58929845-58929867 TGTGCACCTCTGTCCCAAACTGG + Intergenic
931265521 2:60656809-60656831 TGGGCATCCTAATGCCAAGCGGG - Intergenic
935672233 2:105565678-105565700 AGGGCATCTGTGTGCCACACTGG + Intergenic
938338370 2:130518777-130518799 TGGGCCTCTTGATGGCAAACAGG + Intergenic
938351469 2:130601973-130601995 TGGGCCTCTTGATGGCAAACAGG - Intergenic
939186494 2:138867134-138867156 TGGGCATCTCATTGTCAAATAGG + Intergenic
942208983 2:173651642-173651664 TTGGCATCTGGATGCTAAACAGG - Intergenic
944547979 2:200816787-200816809 TGGGCATCTATATGCAATATTGG - Intronic
1168839954 20:903574-903596 TGGTCCTCTCTAAGCCACACGGG - Intronic
1177308732 21:19357556-19357578 TGGTTTTCTGTATGCCAAACAGG + Intergenic
1180457912 22:15528614-15528636 TGGGCATCTCTATGCCAAACTGG + Exonic
1182210612 22:28673452-28673474 TTGGCATTTCTATGCCATAATGG + Intronic
950449160 3:13055904-13055926 TGGGCCTCTCTATGCAAGCCAGG - Intronic
961670532 3:128525168-128525190 GGGGAATCTCTATGTCAGACAGG + Intergenic
969870595 4:10102188-10102210 TGGGCATATCCATGCCTTACTGG + Intronic
979967097 4:127088222-127088244 TGGACATTTATATGCCAAAGAGG + Intergenic
980288492 4:130812812-130812834 TGGTCACCTCTATTCCACACAGG - Intergenic
982639790 4:157944222-157944244 TGGGAATCTGTATGTCAAAAGGG - Intergenic
987752174 5:22054566-22054588 TGGGCAGATCTTTGCCAAAATGG - Intronic
988806015 5:34741490-34741512 TGGCCATCTCTCTGCCAACTAGG - Intronic
992074186 5:73175840-73175862 TAGGCATCTCCAAGACAAACTGG - Intergenic
997719100 5:136063975-136063997 TGAGCCTGTCTTTGCCAAACAGG + Intergenic
998783455 5:145683785-145683807 TGGTCAGCTCCATGCCATACTGG - Intronic
1001910833 5:175516145-175516167 TGGGCAGCCCTATTCCTAACAGG + Intronic
1012547288 6:100433923-100433945 TAGTCATCTCTATGACAAGCTGG - Intronic
1015200482 6:130574364-130574386 TGTTCAGCTTTATGCCAAACAGG + Intergenic
1015459208 6:133469635-133469657 TGGACATCTATATGCAAAAGAGG + Intronic
1022166561 7:27770530-27770552 TGGGCATAAATATGCCCAACCGG - Intronic
1022703862 7:32785413-32785435 TGGGGATCTCTAGGCCAATCTGG - Intergenic
1022908107 7:34875542-34875564 TGGGGATCTCTAGGCCAATCTGG - Intronic
1024581959 7:50807667-50807689 CGGGCATCACTCTCCCAAACTGG - Intergenic
1027632369 7:80622299-80622321 TGGGCCTCTCTTGGCCACACTGG - Intronic
1031262653 7:119541585-119541607 TGGGAATCTCTACCCCAAAAAGG + Intergenic
1031760172 7:125704203-125704225 TTAGCATCTCATTGCCAAACTGG - Intergenic
1034095037 7:148399973-148399995 TGGGCATCTGTATTTCTAACAGG - Intronic
1034941967 7:155236552-155236574 TGCACATCTCCATGCCACACAGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1041215658 8:55597384-55597406 TGGGCCTCTCCATGCCACAGTGG + Intergenic
1042169224 8:65976011-65976033 TGGCCATTTCTATTCCAAAAAGG - Intergenic
1046726829 8:117684779-117684801 TTGGCTTCTCTAGGCCACACTGG + Intergenic
1047797396 8:128272089-128272111 TGGGAACATCTGTGCCAAACTGG + Intergenic
1049255640 8:141612239-141612261 TGGGCATCTCCAGCCCAGACAGG - Intergenic
1050227965 9:3483273-3483295 TTGGCATCTCTGGGCCAAAATGG - Intronic
1059018842 9:110551905-110551927 TGGGGACCTCTATGCCTAAAGGG - Intronic
1060696224 9:125711209-125711231 TGGGCATACCTATGACAATCAGG + Intergenic
1061445847 9:130636751-130636773 TGGGCCTCTCACTGCCAAATTGG + Intronic
1062659863 9:137624341-137624363 TGGGCAACTGGATGCCAGACTGG - Intronic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1188691573 X:33135897-33135919 TAGGAATGTCTGTGCCAAACAGG + Intronic
1189735779 X:44068249-44068271 TGGGCAAGTCTAAACCAAACTGG + Intergenic
1192227964 X:69242351-69242373 TTGGCATCTCTCTGCTAAAATGG - Intergenic
1192505577 X:71680126-71680148 GAGGCATCTCTAAGCCAACCTGG - Intergenic
1193883255 X:86952857-86952879 TTGGCATATATATGCCAAAGAGG - Intergenic
1193986297 X:88244577-88244599 TGGGCATATCTATTCCATATGGG + Intergenic