ID: 1114133161

View in Genome Browser
Species Human (GRCh38)
Location 14:19816732-19816754
Sequence TTGAATAAGGATGGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14050
Summary {0: 1, 1: 8, 2: 90, 3: 1149, 4: 12802}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114133157_1114133161 -3 Left 1114133157 14:19816712-19816734 CCAGAACTTCCAATACTGTGTTG 0: 238
1: 2545
2: 11090
3: 3917
4: 1612
Right 1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG 0: 1
1: 8
2: 90
3: 1149
4: 12802
1114133153_1114133161 12 Left 1114133153 14:19816697-19816719 CCCTGATTGCCCTGGCCAGAACT 0: 55
1: 62
2: 39
3: 75
4: 262
Right 1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG 0: 1
1: 8
2: 90
3: 1149
4: 12802
1114133154_1114133161 11 Left 1114133154 14:19816698-19816720 CCTGATTGCCCTGGCCAGAACTT 0: 6624
1: 7821
2: 3183
3: 2190
4: 2951
Right 1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG 0: 1
1: 8
2: 90
3: 1149
4: 12802
1114133156_1114133161 2 Left 1114133156 14:19816707-19816729 CCTGGCCAGAACTTCCAATACTG 0: 211
1: 2480
2: 10835
3: 3751
4: 1416
Right 1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG 0: 1
1: 8
2: 90
3: 1149
4: 12802
1114133155_1114133161 3 Left 1114133155 14:19816706-19816728 CCCTGGCCAGAACTTCCAATACT 0: 1996
1: 10826
2: 3856
3: 1322
4: 787
Right 1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG 0: 1
1: 8
2: 90
3: 1149
4: 12802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114133161 Original CRISPR TTGAATAAGGATGGTGAGAA AGG Intronic
Too many off-targets to display for this crispr