ID: 1114145494

View in Genome Browser
Species Human (GRCh38)
Location 14:19972042-19972064
Sequence TCTTTACGACTTATCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114145492_1114145494 11 Left 1114145492 14:19972008-19972030 CCTGAATCCACTTCTGTCTTATT No data
Right 1114145494 14:19972042-19972064 TCTTTACGACTTATCTCCTGAGG No data
1114145493_1114145494 4 Left 1114145493 14:19972015-19972037 CCACTTCTGTCTTATTTAGAAGT No data
Right 1114145494 14:19972042-19972064 TCTTTACGACTTATCTCCTGAGG No data
1114145491_1114145494 12 Left 1114145491 14:19972007-19972029 CCCTGAATCCACTTCTGTCTTAT No data
Right 1114145494 14:19972042-19972064 TCTTTACGACTTATCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114145494 Original CRISPR TCTTTACGACTTATCTCCTG AGG Intergenic
No off target data available for this crispr