ID: 1114145495

View in Genome Browser
Species Human (GRCh38)
Location 14:19972043-19972065
Sequence CTTTACGACTTATCTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114145492_1114145495 12 Left 1114145492 14:19972008-19972030 CCTGAATCCACTTCTGTCTTATT No data
Right 1114145495 14:19972043-19972065 CTTTACGACTTATCTCCTGAGGG No data
1114145493_1114145495 5 Left 1114145493 14:19972015-19972037 CCACTTCTGTCTTATTTAGAAGT No data
Right 1114145495 14:19972043-19972065 CTTTACGACTTATCTCCTGAGGG No data
1114145491_1114145495 13 Left 1114145491 14:19972007-19972029 CCCTGAATCCACTTCTGTCTTAT No data
Right 1114145495 14:19972043-19972065 CTTTACGACTTATCTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114145495 Original CRISPR CTTTACGACTTATCTCCTGA GGG Intergenic
No off target data available for this crispr