ID: 1114146119

View in Genome Browser
Species Human (GRCh38)
Location 14:19980071-19980093
Sequence GCAGTTGGTCCAACGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114146117_1114146119 -1 Left 1114146117 14:19980049-19980071 CCATAGACTGAGTTTTTATGCTG No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146115_1114146119 1 Left 1114146115 14:19980047-19980069 CCCCATAGACTGAGTTTTTATGC No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146110_1114146119 27 Left 1114146110 14:19980021-19980043 CCCCAGCATCAGCTGGGAGTCTT No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146114_1114146119 2 Left 1114146114 14:19980046-19980068 CCCCCATAGACTGAGTTTTTATG No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146112_1114146119 25 Left 1114146112 14:19980023-19980045 CCAGCATCAGCTGGGAGTCTTGC No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146116_1114146119 0 Left 1114146116 14:19980048-19980070 CCCATAGACTGAGTTTTTATGCT No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146113_1114146119 3 Left 1114146113 14:19980045-19980067 CCCCCCATAGACTGAGTTTTTAT No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data
1114146111_1114146119 26 Left 1114146111 14:19980022-19980044 CCCAGCATCAGCTGGGAGTCTTG No data
Right 1114146119 14:19980071-19980093 GCAGTTGGTCCAACGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114146119 Original CRISPR GCAGTTGGTCCAACGTTCTG TGG Intergenic
No off target data available for this crispr