ID: 1114152509

View in Genome Browser
Species Human (GRCh38)
Location 14:20060143-20060165
Sequence GATCTACGGTGCTACTGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114152509 Original CRISPR GATCTACGGTGCTACTGTGA TGG Exonic
902303797 1:15521957-15521979 GACCTACAGTGCCACTGAGAAGG + Intronic
904293909 1:29505557-29505579 CATGTACTGTGCTACTGTGTGGG + Intergenic
909161486 1:72156651-72156673 GAACTACAGTGTTTCTGTGATGG + Intronic
910541989 1:88370007-88370029 GGGCTACGGTGCTATTGTCAGGG + Intergenic
912055828 1:105597093-105597115 GATGGAAGGGGCTACTGTGAAGG - Intergenic
913135998 1:115889831-115889853 GATGTACTGTGCTAATGGGAAGG - Intergenic
1064824170 10:19376446-19376468 CATCTACCCAGCTACTGTGAGGG - Intronic
1074698599 10:116073319-116073341 GATGTAAGGTGATCCTGTGAAGG - Intronic
1077845141 11:6015219-6015241 GATGGAAGGGGCTACTGTGAAGG - Intergenic
1087732897 11:101798518-101798540 GATCCTCAGTGCTACTGGGAGGG + Intronic
1114010217 14:18358428-18358450 GATTTATGGTGCTATTGTGGTGG + Intergenic
1114152509 14:20060143-20060165 GATCTACGGTGCTACTGTGATGG + Exonic
1116126626 14:40796678-40796700 GATGGAAGGTGCTGCTGTGAAGG + Intergenic
1118954712 14:70469770-70469792 GATCTACCGGAATACTGTGATGG - Intergenic
1120054835 14:79911452-79911474 GACCAGCTGTGCTACTGTGATGG + Intergenic
1120426062 14:84350245-84350267 GCTCTACATTGCTACTGTAAGGG - Intergenic
1128757825 15:70195462-70195484 GAGCTACGGTGAGACTGTGCAGG - Intergenic
1133582080 16:7154425-7154447 GATCTATTGTCCTTCTGTGATGG - Intronic
1139647896 16:68345371-68345393 GAGCTTTGGTGCTACTCTGATGG + Intronic
1142652246 17:1362268-1362290 GCTGTACTGTGGTACTGTGAAGG - Intronic
1156447618 18:37249049-37249071 AGTCTAGGGTGCTTCTGTGAAGG - Intronic
1158791362 18:60784344-60784366 GATGTAAGGGGCTGCTGTGAAGG - Intergenic
935324548 2:101924673-101924695 GATGAAAGGGGCTACTGTGAAGG - Intergenic
1173277700 20:41598807-41598829 GATGTATGGTGGTACTGTGGTGG + Intronic
1178002751 21:28182237-28182259 GATATTAGGGGCTACTGTGAAGG - Intergenic
1180063076 21:45396298-45396320 GATGAACGGTGCTGCTGTGAAGG + Intergenic
1180434715 22:15289229-15289251 GATTTATGGTGCTATTGTGGTGG + Intergenic
1180535631 22:16391377-16391399 GATCTTCGGGGCTTCTGTGGGGG - Intergenic
1183731611 22:39621686-39621708 GGTCCTCAGTGCTACTGTGAGGG + Intronic
949590723 3:5491551-5491573 GATTAAGGGTGCTACTGTGCCGG + Intergenic
957662112 3:83171538-83171560 CACCTATGGTTCTACTGTGAAGG + Intergenic
959901074 3:111662289-111662311 GATGAAAGGTGCTGCTGTGAAGG + Intronic
967566360 3:190978456-190978478 TACCTACTGTGATACTGTGAAGG - Intergenic
972932529 4:44091050-44091072 AATCTACGCTGCTACAGTCATGG - Intergenic
975730611 4:77334041-77334063 GATGTATGGTGGTACTGTGGTGG - Intronic
990759043 5:59108406-59108428 CATCTAAAGTGCTACTGTTAAGG - Intronic
992789368 5:80199827-80199849 GATCCACTGTGGTACTGTGGTGG - Intronic
1000621760 5:163494184-163494206 GATCCAAAGTGCTACTGTCAGGG - Intergenic
1002690143 5:181044813-181044835 CATCTTCGGGGCTACAGTGATGG - Intronic
1011184721 6:84661627-84661649 GATCTAGAGTGCTGCAGTGATGG - Intergenic
1014685666 6:124496957-124496979 GACCTGCGGTTCTACTCTGAAGG + Intronic
1017892077 6:158646838-158646860 GATCTCAGGTGATACTGAGAAGG - Intergenic
1021397243 7:20165474-20165496 GATTTAGGATGGTACTGTGAGGG - Intronic
1021519631 7:21526594-21526616 GATGGAAGGGGCTACTGTGAAGG - Intergenic
1022896996 7:34760372-34760394 GATTTATAGGGCTACTGTGAAGG - Intronic
1028289241 7:89044960-89044982 GATGGATGGGGCTACTGTGAAGG - Intronic
1033540388 7:142350543-142350565 GATCTAGGGTGCTCCTGTTATGG - Intergenic
1037727551 8:21495641-21495663 GAGCTCCTGTGCTACTATGATGG + Intergenic
1037975168 8:23204059-23204081 GAGCCACCGTGCCACTGTGAAGG + Intronic
1042011933 8:64256358-64256380 GATCCAAGGTGCTAGTGTGTAGG + Intergenic
1050348744 9:4719457-4719479 CAGCTGCGGTGCAACTGTGATGG + Intronic
1055675060 9:78650347-78650369 GATCTCCTGTGCTACACTGAGGG - Intergenic
1058710521 9:107675129-107675151 GTTCTACTGTGCCTCTGTGAAGG + Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1186756024 X:12672364-12672386 GATCAACTGAGCTACTTTGAGGG - Intronic
1189391824 X:40582661-40582683 GATCTACTGAGATACTTTGAGGG + Intronic
1189904512 X:45743860-45743882 GATCTCTGGGGCTACTGAGATGG + Intergenic
1192146649 X:68687137-68687159 GATGTAGGGAGCTACTGTGTAGG - Intronic
1195210791 X:102651333-102651355 GAACTATGGTGGTTCTGTGAGGG + Intergenic
1199907695 X:152251105-152251127 GATCCAAGGTGCTACTGTGTAGG + Intronic