ID: 1114152968

View in Genome Browser
Species Human (GRCh38)
Location 14:20065223-20065245
Sequence ACAATGACTTCAACAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114152966_1114152968 23 Left 1114152966 14:20065177-20065199 CCTTGTGGTTTCTAAGCCTGTAA No data
Right 1114152968 14:20065223-20065245 ACAATGACTTCAACAGTCACAGG No data
1114152967_1114152968 7 Left 1114152967 14:20065193-20065215 CCTGTAACAGCTGAAGTCATTGC No data
Right 1114152968 14:20065223-20065245 ACAATGACTTCAACAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114152968 Original CRISPR ACAATGACTTCAACAGTCAC AGG Intergenic
No off target data available for this crispr