ID: 1114153465

View in Genome Browser
Species Human (GRCh38)
Location 14:20072124-20072146
Sequence TCATCCCCAGCCGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114153465_1114153476 20 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153476 14:20072167-20072189 CACTGTTAATGGCTTAAAAGAGG No data
1114153465_1114153479 26 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153479 14:20072173-20072195 TAATGGCTTAAAAGAGGAAGGGG No data
1114153465_1114153477 24 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153477 14:20072171-20072193 GTTAATGGCTTAAAAGAGGAAGG No data
1114153465_1114153470 -10 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153470 14:20072137-20072159 CTGGGGATGAGCCTTTCAAAGGG No data
1114153465_1114153478 25 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153478 14:20072172-20072194 TTAATGGCTTAAAAGAGGAAGGG No data
1114153465_1114153472 9 Left 1114153465 14:20072124-20072146 CCACCGTGCCCGGCTGGGGATGA No data
Right 1114153472 14:20072156-20072178 AGGGTCCCGTCCACTGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114153465 Original CRISPR TCATCCCCAGCCGGGCACGG TGG (reversed) Intergenic