ID: 1114159194

View in Genome Browser
Species Human (GRCh38)
Location 14:20144147-20144169
Sequence GATAATGCATAGCAGGCTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114159194_1114159200 -3 Left 1114159194 14:20144147-20144169 CCTAGAGCCTGCTATGCATTATC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1114159200 14:20144167-20144189 ATCGTTGGTTCTGTGGCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 233
1114159194_1114159197 -10 Left 1114159194 14:20144147-20144169 CCTAGAGCCTGCTATGCATTATC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1114159197 14:20144160-20144182 ATGCATTATCGTTGGTTCTGTGG 0: 1
1: 0
2: 1
3: 5
4: 105
1114159194_1114159198 -5 Left 1114159194 14:20144147-20144169 CCTAGAGCCTGCTATGCATTATC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1114159198 14:20144165-20144187 TTATCGTTGGTTCTGTGGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 121
1114159194_1114159199 -4 Left 1114159194 14:20144147-20144169 CCTAGAGCCTGCTATGCATTATC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1114159199 14:20144166-20144188 TATCGTTGGTTCTGTGGCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1114159194_1114159201 -2 Left 1114159194 14:20144147-20144169 CCTAGAGCCTGCTATGCATTATC 0: 1
1: 0
2: 2
3: 22
4: 170
Right 1114159201 14:20144168-20144190 TCGTTGGTTCTGTGGCTTGGGGG 0: 1
1: 0
2: 1
3: 74
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114159194 Original CRISPR GATAATGCATAGCAGGCTCT AGG (reversed) Exonic
902965706 1:20000005-20000027 GATAATGCTTAGCAGGCTGCAGG - Intergenic
904614416 1:31742296-31742318 CTGAATGCCTAGCAGGCTCTGGG - Intronic
906774494 1:48516974-48516996 GATAATGCTTAGCAGGCTGCAGG + Intergenic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
908059481 1:60331828-60331850 GATAATGCATATGAAGCACTTGG + Intergenic
909154179 1:72049887-72049909 GGTAATGCATATCAGGCTCTGGG + Intronic
912715240 1:111978862-111978884 GATTATACATAGCAAGCACTTGG - Intronic
916068803 1:161158055-161158077 CATAAAGCACAGCAGCCTCTTGG - Intronic
916618466 1:166470236-166470258 AATGATGAATAACAGGCTCTGGG + Intergenic
917799479 1:178557716-178557738 GATAACGCTTAGCAGGCTGCAGG + Intergenic
920427999 1:205893960-205893982 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
921226858 1:213029177-213029199 GATAATGCTTAGCAGGCTGCAGG + Intergenic
922452741 1:225750120-225750142 GATAGTGCACAGAAAGCTCTTGG + Intergenic
1063808189 10:9672026-9672048 CAAAATGAATAGCAGGCTTTTGG + Intergenic
1067133582 10:43588230-43588252 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1069491494 10:68865238-68865260 GAAAATGCTTAGCAGGCTGCAGG + Intronic
1070091871 10:73294913-73294935 GATAATTGATGGCAGGCTCAGGG - Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1070381383 10:75883344-75883366 GATTGTGCCAAGCAGGCTCTGGG + Intronic
1077539534 11:3140013-3140035 GATCATTCATCGCAAGCTCTGGG + Intronic
1078896422 11:15600889-15600911 GATAATGCATATCAACCTCAAGG + Intergenic
1079580758 11:22061462-22061484 TAAAATGCATAGCAGGCTGTTGG + Intergenic
1080443391 11:32315368-32315390 GATAATGCATACAAAGCTCCTGG - Intergenic
1084680754 11:70664883-70664905 CATTTTGCAGAGCAGGCTCTGGG - Intronic
1086121209 11:83306146-83306168 GATAATGCATACAAAGCACTTGG + Intergenic
1087081549 11:94175740-94175762 CATAATTCATAGCTGGCTGTGGG - Intronic
1087832585 11:102835534-102835556 GACATTGTAGAGCAGGCTCTAGG - Intergenic
1088492225 11:110399484-110399506 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1089337919 11:117737844-117737866 GAGATGGCATGGCAGGCTCTGGG + Intronic
1096429329 12:51530427-51530449 GATACTGCATTCCAGGCACTGGG + Intergenic
1096498744 12:52053175-52053197 AATAATGCAGAGGAGGCTCCAGG - Intronic
1097622616 12:61959294-61959316 GATTAGGCATAGCATGCTCTTGG - Intronic
1099115909 12:78623810-78623832 AATAATGCAGAGCACGTTCTTGG + Intergenic
1099674934 12:85746570-85746592 TATAAAGAATAGCAGCCTCTAGG + Intergenic
1100897882 12:99205012-99205034 GATAATGTATAGGAGGCCATTGG + Intronic
1101223491 12:102664894-102664916 GATAACGCTTAGCAGGCTGCAGG + Intergenic
1101501272 12:105306501-105306523 GATAATGCTTAGCAGGCTGCAGG + Intronic
1101710825 12:107263724-107263746 GATATTATATATCAGGCTCTTGG - Intergenic
1102716191 12:114974995-114975017 GATAATGCAAAGCAGACTGTCGG - Intergenic
1103096556 12:118136776-118136798 CATAATGCGTCACAGGCTCTCGG - Intronic
1104501324 12:129288741-129288763 AATAATGGAAAGCAGGATCTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1114159194 14:20144147-20144169 GATAATGCATAGCAGGCTCTAGG - Exonic
1116238416 14:42310906-42310928 GAAAATGCTTAGCAGGCTGTAGG + Intergenic
1117082848 14:52168886-52168908 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1119742440 14:77023003-77023025 GATAATGCATAGCAGACTGTAGG - Intergenic
1123574391 15:21652346-21652368 ATCATTGCATAGCAGGCTCTAGG - Intergenic
1123611006 15:22094933-22094955 ATCATTGCATAGCAGGCTCTAGG - Exonic
1126118410 15:45229578-45229600 GATAATGCATGGAAGGCCCTTGG + Intergenic
1128397044 15:67237972-67237994 CATAATGCCTAGCAGTCTTTTGG - Intronic
1130003788 15:80073509-80073531 GAAAATGCTTAGCTGGCTTTTGG - Intronic
1130534489 15:84773965-84773987 GATAATGCCTAGCATTTTCTGGG + Intronic
1202983254 15_KI270727v1_random:386689-386711 ATCATTGCATAGCAGGCTCTAGG - Intergenic
1133202600 16:4213324-4213346 AATAATGGATAGGAGGCTCAAGG - Intronic
1133798876 16:9068661-9068683 GTTCAGGCAAAGCAGGCTCTGGG - Intergenic
1133953756 16:10421841-10421863 GAAAATGCTTAGCAGGCTGCAGG + Intronic
1134153165 16:11820994-11821016 GAAAATGCATAGTAGGCCCAAGG - Intergenic
1135501796 16:23002355-23002377 GATAATGCCTAGGAAGCACTTGG - Intergenic
1136638572 16:31542125-31542147 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1136921917 16:34339570-34339592 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1136982656 16:35072236-35072258 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1138957270 16:61986299-61986321 GAAAATGCATAGTAGACTCAAGG + Intronic
1148232118 17:45942841-45942863 GACAATGCAAAGGAGGCTCTGGG + Intronic
1148634627 17:49138957-49138979 GATAATGCACACAAAGCTCTTGG + Intronic
1148639335 17:49174363-49174385 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1151346644 17:73506633-73506655 GATTATGCACATCAGGCCCTGGG + Intronic
1156501369 18:37561318-37561340 TAAAATGCATCGTAGGCTCTGGG + Intronic
1156794809 18:41031146-41031168 GATACTGCTTAGCAGCCTCCAGG - Intergenic
1157151629 18:45224158-45224180 GACACTGCACAGCAGCCTCTTGG - Intronic
1157937435 18:51888617-51888639 GATAATTCATATCAGGGTCCAGG + Intergenic
1160000257 18:75012412-75012434 CATAGTGTATAGCAGGCTCTGGG + Intronic
1160061875 18:75536359-75536381 GAGGATGCATAGCAGCATCTTGG + Intergenic
1161474659 19:4477626-4477648 TATAATGCTTAGCAAGCTGTAGG - Intronic
1162282992 19:9715247-9715269 GATAATGCTTAGCAGGCTACAGG + Intergenic
1162642718 19:12024385-12024407 GAAAATGCTTAGCAGGCTGCAGG - Intronic
1162652488 19:12101005-12101027 GAAAATGCTTAGCAGGCTGCAGG + Intronic
1163874061 19:19851473-19851495 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163903924 19:20134428-20134450 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163910231 19:20183101-20183123 GAGAATGCAGAGAAAGCTCTGGG - Intronic
1163932628 19:20411801-20411823 GAGAATGCAGAGAAAGCTCTGGG + Intergenic
1163970669 19:20790951-20790973 GAGAATGAAGAGAAGGCTCTGGG - Intronic
1164306228 19:24005981-24006003 GAAAATGCCTAGCAGGCTGCAGG + Intergenic
1166209442 19:41296731-41296753 GATGATGCATAGCTGTCTCCTGG + Intronic
1167258947 19:48446856-48446878 GAGTATGCAGAGCAGGCTCCTGG - Intronic
927265495 2:21144624-21144646 GATAATACATATAAGACTCTTGG - Intergenic
928118283 2:28563666-28563688 GATAGTGCTTTGCAGGGTCTGGG - Intronic
932498362 2:72158966-72158988 GATAATGCATGCCAAGCACTTGG + Intergenic
933780679 2:85798759-85798781 GCTACTGCCTGGCAGGCTCTGGG + Intergenic
935832830 2:107018570-107018592 GATAATGCACATAAGGCTCTTGG + Intergenic
936037915 2:109127910-109127932 AATAATATATAGCACGCTCTTGG + Intergenic
936799877 2:116253946-116253968 GAAAATGCTTAGCAGGCTGAAGG - Intergenic
936829611 2:116627258-116627280 GAAAATGCAATGCAGGCTTTGGG + Intergenic
938859982 2:135358006-135358028 TATAATAAATAGCAGGCGCTGGG - Intronic
939073025 2:137566548-137566570 GATACTGCATGGCAGGATGTAGG - Intronic
939115338 2:138054106-138054128 GATAATGTCTAGCATGCTATAGG + Intergenic
940310816 2:152277246-152277268 GATAATGCTTAGCAGGCTGCAGG + Intergenic
943148536 2:184078598-184078620 GATACTGCATGGCAGGATCCAGG + Intergenic
944944069 2:204662944-204662966 GATAATGCAAACCAGGCATTTGG - Intronic
945890399 2:215425082-215425104 GATAATGCATACCTGTCTCTTGG + Exonic
1170114669 20:12844514-12844536 GATTTTGCATATCAGGCTGTTGG - Intergenic
1171229351 20:23470321-23470343 GATAACGCTTAGCAGGCTGCAGG - Intergenic
1172581814 20:36054295-36054317 GATAGGGAAGAGCAGGCTCTGGG - Intergenic
1172762096 20:37330145-37330167 GTTAATGCATATAAGGCACTTGG + Intergenic
1173791185 20:45828757-45828779 GACAACCGATAGCAGGCTCTGGG + Intronic
1174860405 20:54086099-54086121 GATAATGCACAGCACGCGCTTGG + Intergenic
1175954678 20:62603215-62603237 GCTAAGCCATAGCAGGCTCGTGG + Intergenic
1180137624 21:45871486-45871508 GATACTGCAGAGGTGGCTCTGGG + Intronic
1181330340 22:22086164-22086186 GGGAATGCACAGCTGGCTCTGGG + Intergenic
1181988089 22:26815622-26815644 GAGAATGCATTGAAGGGTCTGGG + Intergenic
1182038130 22:27215386-27215408 GATAACTCACAGGAGGCTCTTGG - Intergenic
1183262593 22:36805335-36805357 CCTGATGCATAGCAAGCTCTCGG + Intronic
1183481670 22:38068786-38068808 GATGTTGCGTAGCAGGCCCTGGG + Intronic
1184234048 22:43173739-43173761 GATGATGCTGTGCAGGCTCTTGG + Exonic
949519899 3:4841410-4841432 GAAAATGCATGGCATGCTCAAGG + Intronic
951458092 3:22916157-22916179 GTTAATTCATACCAGCCTCTTGG + Intergenic
951509304 3:23484176-23484198 GATAAAGCATAACAGGCTAAAGG - Intronic
952720141 3:36524018-36524040 GATTATGTATGGCAGGCTGTGGG + Intronic
954232761 3:49230449-49230471 GAAAATGCTTAGCAGGCTGCAGG - Intronic
955411127 3:58656229-58656251 GATAATGCATAGATGGCACCTGG - Intronic
956190699 3:66605268-66605290 GATAATGCATGTCAGGTGCTTGG + Intergenic
957099135 3:75806781-75806803 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
961323440 3:126094693-126094715 GAAAATGCTTAGCAGGCTGCAGG - Intronic
962676511 3:137762199-137762221 GTTAATGCAAACCAAGCTCTTGG - Intergenic
963995498 3:151703579-151703601 GAAAATGCTTAGCAGGCTGAAGG - Intergenic
964738961 3:159945461-159945483 GATATTGCATATAAGGCACTTGG - Intergenic
965315017 3:167180695-167180717 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
965694603 3:171394417-171394439 AATAAAGCATAGGAGGCTGTGGG - Intronic
966009146 3:175054260-175054282 GAAAATGCTTAGCAGGCTTCAGG + Intronic
966886945 3:184382067-184382089 GGCAATGCAGAGCATGCTCTCGG - Intronic
967738418 3:192979193-192979215 AATAATGCTTACCAGACTCTGGG + Intergenic
969895529 4:10300948-10300970 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
971424460 4:26502487-26502509 CATAATGTATGGCAGGCCCTGGG + Intergenic
977016511 4:91698723-91698745 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
977313497 4:95415433-95415455 GATGATTCATAGCAAACTCTTGG + Intronic
977642204 4:99369462-99369484 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
979343584 4:119558200-119558222 GATAAAGCATAGTAAGCTCTTGG - Intronic
989742708 5:44791318-44791340 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
990306794 5:54501886-54501908 GATAATGCTTAGTAGGCTGCAGG + Intergenic
995711393 5:115039780-115039802 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1000918065 5:167106109-167106131 GATAATGCCTATAAAGCTCTTGG + Intergenic
1003433720 6:6066291-6066313 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1004202274 6:13560131-13560153 GACAATGCATGGCAGGATCCAGG + Intergenic
1007886702 6:45238028-45238050 GAAAATGCTTAGCAGGCTGCAGG - Intronic
1008066795 6:47058812-47058834 GACAAGGGATGGCAGGCTCTTGG - Intergenic
1008327227 6:50197446-50197468 GAAAATGCCAAGCATGCTCTGGG + Intergenic
1009062659 6:58416419-58416441 AATAATGCTTAGCAGGCTGCAGG + Intergenic
1009250341 6:61290977-61290999 AATAATGCTTAGCAGGCTGCAGG + Intergenic
1012325571 6:97911686-97911708 GATAATTCTTAGCAGGCTTGAGG - Intergenic
1013519468 6:110919339-110919361 GAAAACGCTTAGCAGGCTGTAGG - Intergenic
1013739456 6:113266050-113266072 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1014151121 6:118056764-118056786 GATAATGATTATCAGGCTCATGG - Intronic
1014388299 6:120828852-120828874 GATAAGGCATATAAAGCTCTTGG - Intergenic
1015041517 6:128726245-128726267 GATTATGCATATCAGACTATGGG + Intergenic
1016447171 6:144146258-144146280 GATAAAACAGAGCAGGCACTGGG - Intergenic
1020620732 7:10515454-10515476 GTTAATGCATAGTAGGATATTGG - Intergenic
1023092301 7:36628565-36628587 GATAAGGCGGAGCAGGCACTAGG + Intronic
1023853372 7:44163280-44163302 GATAATGCAGGTAAGGCTCTTGG + Intronic
1024101980 7:46041872-46041894 GATAACGCTTAGCAGGCTGCAGG + Intergenic
1024911439 7:54451441-54451463 GATAACGCTTAGCAGGCTGCAGG - Intergenic
1025122807 7:56319658-56319680 GATAATGCTTAGTAGGCTGCAGG - Intergenic
1026368068 7:69669945-69669967 CATAATGGATAGCAGGGTTTGGG + Intronic
1027617061 7:80436356-80436378 GAAAATGTATAACAGGCTCAAGG + Intronic
1030581210 7:111358219-111358241 GATAATGCATCTGAGGCTGTGGG - Intronic
1032154171 7:129454667-129454689 GATACTGCATGGCAGGCACAAGG + Intronic
1034942599 7:155240902-155240924 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1035979926 8:4359193-4359215 GATAATGCAACTCATGCTCTGGG - Intronic
1036189430 8:6656782-6656804 GGTAGGGCAGAGCAGGCTCTTGG + Intergenic
1036446773 8:8828545-8828567 GAAACTGAATTGCAGGCTCTAGG - Intronic
1037747204 8:21655394-21655416 ACTGAGGCATAGCAGGCTCTAGG - Intergenic
1038952717 8:32433343-32433365 GATTATGGATAGCAGGCTCCTGG + Intronic
1040468432 8:47716575-47716597 GATAATGCTCAGGAGGCTTTGGG + Intronic
1042497586 8:69472147-69472169 GATAATAAAGAGCAGGCCCTGGG + Intronic
1042758537 8:72245399-72245421 GGTGATGCCTAGCAGGCTGTTGG - Intergenic
1044695480 8:94918332-94918354 GATAGTGCAGAGTAGGCCCTGGG + Intronic
1045314614 8:101032572-101032594 TAAAATCCGTAGCAGGCTCTAGG + Intergenic
1047193111 8:122696417-122696439 GATAATGAGTAGGAGGCTTTTGG - Intergenic
1047563094 8:126010318-126010340 GATAACGCTTAGCAGGCTGCAGG - Intergenic
1048164002 8:132046011-132046033 TCTAGTGCATAGCAGGCTCTAGG - Intronic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1053126469 9:35584813-35584835 GAAAATGCTTAGCAGGCTGCAGG - Intergenic
1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG + Intergenic
1057285792 9:93753059-93753081 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1061295991 9:129677019-129677041 CAAAATGCAGAGCAGGATCTTGG - Intronic
1185923975 X:4125906-4125928 GATCATGGTTACCAGGCTCTAGG - Intergenic
1190738667 X:53272947-53272969 GATAATGCATGTAAGGCTCCTGG - Intronic
1191149544 X:57206614-57206636 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1191580560 X:62756451-62756473 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1192194471 X:69019079-69019101 GGTAATGCACAGCATGCTCCAGG + Intergenic
1192510306 X:71717278-71717300 GAAAATGCAGAGCAGGGCCTGGG - Exonic
1192516391 X:71764275-71764297 GAAAATGCAGAGCAGGGCCTGGG + Exonic
1192529427 X:71872419-71872441 GAAAATGCAGAGCAGGGCCTGGG - Intergenic
1192687425 X:73321913-73321935 GATAATGCTTAGCAGGCTGCAGG + Intergenic
1197821880 X:130549708-130549730 GAAAATGCTTAGCTGGCTTTTGG - Intergenic
1201362947 Y:13173419-13173441 GAAAATGCTTAGCAGGCTGCAGG + Intergenic
1201700444 Y:16875649-16875671 GATAATGCTTAGCAGGCTGCAGG - Intergenic