ID: 1114166191

View in Genome Browser
Species Human (GRCh38)
Location 14:20220725-20220747
Sequence ATTAATAATAATAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114166187_1114166191 16 Left 1114166187 14:20220686-20220708 CCAGCCTGGACCACATAGCAAGA 0: 13
1: 825
2: 10860
3: 70603
4: 191002
Right 1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG No data
1114166189_1114166191 6 Left 1114166189 14:20220696-20220718 CCACATAGCAAGACTCTGTCTCA No data
Right 1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG No data
1114166188_1114166191 12 Left 1114166188 14:20220690-20220712 CCTGGACCACATAGCAAGACTCT No data
Right 1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG No data
1114166186_1114166191 26 Left 1114166186 14:20220676-20220698 CCACTGCACTCCAGCCTGGACCA 0: 170
1: 9002
2: 151363
3: 267832
4: 223495
Right 1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114166191 Original CRISPR ATTAATAATAATAAGCAGGA AGG Intergenic
No off target data available for this crispr