ID: 1114167605

View in Genome Browser
Species Human (GRCh38)
Location 14:20235874-20235896
Sequence GCAAGGCGGCAGCGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6328
Summary {0: 1061, 1: 2132, 2: 1737, 3: 742, 4: 656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167605_1114167613 30 Left 1114167605 14:20235874-20235896 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167605_1114167612 24 Left 1114167605 14:20235874-20235896 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167605_1114167611 23 Left 1114167605 14:20235874-20235896 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167605 Original CRISPR GCAAGGCGGCAGCGAGGCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr