ID: 1114167606

View in Genome Browser
Species Human (GRCh38)
Location 14:20235875-20235897
Sequence TGCAAGGCGGCAGCGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6159
Summary {0: 1085, 1: 2164, 2: 1733, 3: 667, 4: 510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167606_1114167612 23 Left 1114167606 14:20235875-20235897 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167606_1114167611 22 Left 1114167606 14:20235875-20235897 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1114167606_1114167613 29 Left 1114167606 14:20235875-20235897 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167606 Original CRISPR TGCAAGGCGGCAGCGAGGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr