ID: 1114167607

View in Genome Browser
Species Human (GRCh38)
Location 14:20235876-20235898
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6148
Summary {0: 1065, 1: 2097, 2: 1670, 3: 692, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167607_1114167613 28 Left 1114167607 14:20235876-20235898 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167607_1114167611 21 Left 1114167607 14:20235876-20235898 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1114167607_1114167612 22 Left 1114167607 14:20235876-20235898 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167607 Original CRISPR CTGCAAGGCGGCAGCGAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr