ID: 1114167608

View in Genome Browser
Species Human (GRCh38)
Location 14:20235880-20235902
Sequence CAAACTGCAAGGCGGCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6143
Summary {0: 1083, 1: 2030, 2: 1615, 3: 820, 4: 595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167608_1114167612 18 Left 1114167608 14:20235880-20235902 CCTCGCTGCCGCCTTGCAGTTTG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167608_1114167611 17 Left 1114167608 14:20235880-20235902 CCTCGCTGCCGCCTTGCAGTTTG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1114167608_1114167613 24 Left 1114167608 14:20235880-20235902 CCTCGCTGCCGCCTTGCAGTTTG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167608 Original CRISPR CAAACTGCAAGGCGGCAGCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr