ID: 1114167609

View in Genome Browser
Species Human (GRCh38)
Location 14:20235888-20235910
Sequence TCTGTGATCAAACTGCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167609_1114167611 9 Left 1114167609 14:20235888-20235910 CCGCCTTGCAGTTTGATCACAGA No data
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978
1114167609_1114167612 10 Left 1114167609 14:20235888-20235910 CCGCCTTGCAGTTTGATCACAGA No data
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167609_1114167613 16 Left 1114167609 14:20235888-20235910 CCGCCTTGCAGTTTGATCACAGA No data
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167609 Original CRISPR TCTGTGATCAAACTGCAAGG CGG (reversed) Intergenic
No off target data available for this crispr