ID: 1114167610

View in Genome Browser
Species Human (GRCh38)
Location 14:20235891-20235913
Sequence CAGTCTGTGATCAAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6518
Summary {0: 20, 1: 3687, 2: 1421, 3: 733, 4: 657}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167610_1114167613 13 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167610_1114167615 28 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167615 14:20235942-20235964 GGCGTAGGACCCTCCGAGCCAGG 0: 878
1: 1519
2: 1252
3: 938
4: 674
1114167610_1114167612 7 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167610_1114167611 6 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167611 14:20235920-20235942 TAGCAATCAGCGAGACACCGTGG 0: 5
1: 920
2: 1493
3: 979
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167610 Original CRISPR CAGTCTGTGATCAAACTGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr