ID: 1114167612

View in Genome Browser
Species Human (GRCh38)
Location 14:20235921-20235943
Sequence AGCAATCAGCGAGACACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4326
Summary {0: 5, 1: 909, 2: 1484, 3: 974, 4: 954}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167602_1114167612 29 Left 1114167602 14:20235869-20235891 CCCTCCCCCAGCCTCGCTGCCGC 0: 1025
1: 2065
2: 1803
3: 995
4: 1258
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167609_1114167612 10 Left 1114167609 14:20235888-20235910 CCGCCTTGCAGTTTGATCACAGA No data
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167608_1114167612 18 Left 1114167608 14:20235880-20235902 CCTCGCTGCCGCCTTGCAGTTTG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167601_1114167612 30 Left 1114167601 14:20235868-20235890 CCCCTCCCCCAGCCTCGCTGCCG 0: 1015
1: 2056
2: 1763
3: 968
4: 1261
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167604_1114167612 25 Left 1114167604 14:20235873-20235895 CCCCCAGCCTCGCTGCCGCCTTG 0: 1037
1: 2094
2: 1697
3: 760
4: 655
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167603_1114167612 28 Left 1114167603 14:20235870-20235892 CCTCCCCCAGCCTCGCTGCCGCC 0: 985
1: 2028
2: 1771
3: 1042
4: 1585
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167607_1114167612 22 Left 1114167607 14:20235876-20235898 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167610_1114167612 7 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167606_1114167612 23 Left 1114167606 14:20235875-20235897 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954
1114167605_1114167612 24 Left 1114167605 14:20235874-20235896 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1114167612 14:20235921-20235943 AGCAATCAGCGAGACACCGTGGG 0: 5
1: 909
2: 1484
3: 974
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167612 Original CRISPR AGCAATCAGCGAGACACCGT GGG Intergenic
Too many off-targets to display for this crispr