ID: 1114167613

View in Genome Browser
Species Human (GRCh38)
Location 14:20235927-20235949
Sequence CAGCGAGACACCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114167608_1114167613 24 Left 1114167608 14:20235880-20235902 CCTCGCTGCCGCCTTGCAGTTTG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167605_1114167613 30 Left 1114167605 14:20235874-20235896 CCCCAGCCTCGCTGCCGCCTTGC 0: 1061
1: 2132
2: 1737
3: 742
4: 656
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167606_1114167613 29 Left 1114167606 14:20235875-20235897 CCCAGCCTCGCTGCCGCCTTGCA 0: 1085
1: 2164
2: 1733
3: 667
4: 510
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167610_1114167613 13 Left 1114167610 14:20235891-20235913 CCTTGCAGTTTGATCACAGACTG 0: 20
1: 3687
2: 1421
3: 733
4: 657
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167607_1114167613 28 Left 1114167607 14:20235876-20235898 CCAGCCTCGCTGCCGCCTTGCAG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data
1114167609_1114167613 16 Left 1114167609 14:20235888-20235910 CCGCCTTGCAGTTTGATCACAGA No data
Right 1114167613 14:20235927-20235949 CAGCGAGACACCGTGGGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114167613 Original CRISPR CAGCGAGACACCGTGGGCGT AGG Intergenic
No off target data available for this crispr