ID: 1114168640

View in Genome Browser
Species Human (GRCh38)
Location 14:20248410-20248432
Sequence TCCAGCTGGTCTCCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114168640_1114168645 30 Left 1114168640 14:20248410-20248432 CCAGGAGTTGGAGACCAGCTGGA No data
Right 1114168645 14:20248463-20248485 AAAAAATTAGCCAGGCGTGGTGG 0: 14455
1: 74040
2: 160786
3: 193764
4: 190433
1114168640_1114168643 22 Left 1114168640 14:20248410-20248432 CCAGGAGTTGGAGACCAGCTGGA No data
Right 1114168643 14:20248455-20248477 TTAAAAAAAAAAAATTAGCCAGG 0: 114
1: 790
2: 16458
3: 138945
4: 291236
1114168640_1114168644 27 Left 1114168640 14:20248410-20248432 CCAGGAGTTGGAGACCAGCTGGA No data
Right 1114168644 14:20248460-20248482 AAAAAAAAATTAGCCAGGCGTGG 0: 1870
1: 14045
2: 62141
3: 159309
4: 199826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114168640 Original CRISPR TCCAGCTGGTCTCCAACTCC TGG (reversed) Intergenic
No off target data available for this crispr