ID: 1114173159

View in Genome Browser
Species Human (GRCh38)
Location 14:20295047-20295069
Sequence CTATATCCATAGTTGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114173159_1114173166 15 Left 1114173159 14:20295047-20295069 CCAAATTTCAACTATGGATATAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1114173166 14:20295085-20295107 CAAACTCAGGGATACAAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 213
1114173159_1114173161 2 Left 1114173159 14:20295047-20295069 CCAAATTTCAACTATGGATATAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1114173161 14:20295072-20295094 ATCCACATAGCACCAAACTCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
1114173159_1114173162 3 Left 1114173159 14:20295047-20295069 CCAAATTTCAACTATGGATATAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1114173162 14:20295073-20295095 TCCACATAGCACCAAACTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 155
1114173159_1114173165 14 Left 1114173159 14:20295047-20295069 CCAAATTTCAACTATGGATATAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1114173165 14:20295084-20295106 CCAAACTCAGGGATACAAAATGG 0: 1
1: 0
2: 0
3: 17
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114173159 Original CRISPR CTATATCCATAGTTGAAATT TGG (reversed) Intronic
904205728 1:28854063-28854085 CTATATACATATATGTAATTTGG + Intronic
904249245 1:29211004-29211026 CCATCTCCATTGTTGAACTTGGG + Intronic
909212635 1:72843952-72843974 CTATGTGCATAGGAGAAATTTGG - Intergenic
909645965 1:77917881-77917903 TTATATGCAGAGTTTAAATTAGG - Intronic
910447774 1:87316264-87316286 CAATATACACAGTTTAAATTGGG + Intergenic
910848162 1:91623770-91623792 CTATATCAAGAGTTGCCATTAGG - Intergenic
911140837 1:94500851-94500873 CTATATTCAAAATGGAAATTAGG + Intronic
911405848 1:97438285-97438307 CTTTATCCATAGATAAAAATGGG + Intronic
911810626 1:102273843-102273865 TTCTATCCATTATTGAAATTAGG + Intergenic
912277767 1:108278471-108278493 AGATATCCATTGTTGAAACTGGG + Intergenic
912290459 1:108415888-108415910 AGATATCCATTGTTGAAACTGGG - Intronic
914438862 1:147684441-147684463 ATCTATCCATTGTTGAAAGTAGG - Intergenic
914678897 1:149925325-149925347 ATATATCTATAGTTTTAATTGGG - Intronic
916447126 1:164882865-164882887 CTATATACTTAGTTTAAATTTGG + Intronic
916595508 1:166238707-166238729 CAACATCCATAGTTTACATTAGG + Intergenic
916693494 1:167213776-167213798 GGATATTAATAGTTGAAATTGGG + Intergenic
916938073 1:169651353-169651375 CAAAGTCCATAGTTGACATTAGG - Intergenic
916949066 1:169760354-169760376 CAAAATCCATAGTTTATATTAGG + Intronic
917070814 1:171148799-171148821 CTAAATCTCTAGCTGAAATTAGG - Intronic
917442302 1:175078784-175078806 CTGTACCCATAGTTGAGAGTAGG + Intronic
917535430 1:175871243-175871265 CTAAATGCATATCTGAAATTTGG + Intergenic
917947174 1:179986506-179986528 CTATATCATTTATTGAAATTAGG - Intronic
918465518 1:184817840-184817862 CTATAACAATAGTTGAGTTTTGG + Intronic
921605597 1:217150573-217150595 CAATGTCCATAGTTTACATTAGG - Intergenic
921744251 1:218720253-218720275 TTATATTCAGAGTTGAATTTAGG - Intergenic
923422389 1:233830128-233830150 CTTTATCCATTATTGAAAGTGGG + Intergenic
923424246 1:233853205-233853227 CAACATCCATAGTTTACATTAGG - Intergenic
1063007142 10:1983911-1983933 CTATATCCATGATGGACATTTGG + Intergenic
1063849711 10:10173307-10173329 CAATATCCATAGCTTACATTAGG + Intergenic
1065103976 10:22361286-22361308 CTATATCCAATGTCAAAATTAGG - Intronic
1065462222 10:25980858-25980880 CAAAATCCATAGTTTACATTAGG + Intronic
1066534596 10:36377333-36377355 ATTTATCCATTGTTGAAAGTGGG + Intergenic
1068298438 10:55106832-55106854 CTATATCCATAGCTGACCTAGGG - Intronic
1070316275 10:75316139-75316161 TTCTATCCATTGTTGAAAGTGGG - Intergenic
1071004067 10:80862171-80862193 CTAGATCCATAGGTTAATTTTGG + Intergenic
1071104570 10:82079490-82079512 CAGAATCCATAGTTGACATTAGG + Intronic
1071802821 10:89083631-89083653 GTCTTTCCATAGTTAAAATTTGG + Intergenic
1072113663 10:92347845-92347867 CTATATCCATAGCTCAAATTTGG + Intronic
1074479246 10:113803623-113803645 CTCTATCCATATCTGATATTTGG - Intergenic
1074629577 10:115236760-115236782 CTAAGTCCATAGTTTATATTAGG + Intronic
1077380180 11:2230407-2230429 ATCTATCCATTGTTGAAAGTGGG - Intergenic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1079341415 11:19614599-19614621 CAATGTCCATAGTTCACATTAGG + Intronic
1079619546 11:22536412-22536434 TGTTATCCATAGTTGTAATTAGG + Intergenic
1080335024 11:31185928-31185950 CTATATTCATAGTTGTATTTTGG - Intronic
1082769346 11:57194442-57194464 CTATATCTACAGTGGATATTGGG + Intergenic
1083014324 11:59437188-59437210 CAAAATCCATAGTTAACATTTGG + Intergenic
1083479940 11:62937432-62937454 CTACATCCAAAATAGAAATTTGG + Intronic
1084897746 11:72287111-72287133 CTATGGCCATAGGTGAGATTAGG + Intergenic
1085938383 11:81178378-81178400 CCAAATCCATAGTTTACATTAGG + Intergenic
1086028128 11:82319563-82319585 CTATGGCCATAGGTAAAATTAGG + Intergenic
1086207402 11:84275837-84275859 TTATATCCATGGTGGACATTAGG + Intronic
1086614472 11:88799658-88799680 ATATATCCATATTTAAACTTAGG - Intronic
1087082192 11:94182028-94182050 CTATTTACATAGTTGGAATTGGG - Intergenic
1087743604 11:101916949-101916971 CTAAATATATAGTTAAAATTAGG + Intronic
1087955537 11:104282311-104282333 CAAAGTCCATAGTTGATATTAGG + Intergenic
1088364759 11:109028915-109028937 CAAAATCCATAGTTTATATTAGG + Intergenic
1090544107 11:127743822-127743844 CCAAATCCATAGTTTACATTAGG + Intergenic
1092393292 12:8100878-8100900 ATCTATCCATTGTTGAAAGTGGG - Intergenic
1093642852 12:21547740-21547762 CAAGATCCATAGTTTACATTAGG - Intronic
1094321896 12:29193256-29193278 CAAAATCCATAGTTTACATTAGG + Intronic
1095319723 12:40812477-40812499 ATTTATCCATTGTTGAAAATGGG + Intronic
1095403087 12:41837943-41837965 TTATATGCCCAGTTGAAATTTGG - Intergenic
1097477364 12:60074645-60074667 CTAGCACAATAGTTGAAATTTGG + Intergenic
1097524783 12:60718354-60718376 ATATATCCAAAGTTTACATTAGG - Intergenic
1098096040 12:66957079-66957101 CTATAACCATATTTGAGATAGGG + Intergenic
1098157081 12:67610213-67610235 CTAAATCCATAGTTCACACTAGG - Intergenic
1098754624 12:74344713-74344735 TTATATCCAAAGTTGTACTTTGG - Intergenic
1098754696 12:74346089-74346111 TTATATCCAAAGTTGTACTTTGG + Intergenic
1100052649 12:90468513-90468535 CTTTATCCATTGTTGAAAGTGGG + Intergenic
1101038647 12:100731520-100731542 CAAAATCCATAGTTTATATTAGG + Intronic
1103181534 12:118916356-118916378 CTAAATACATAGTTGAGAATCGG + Intergenic
1103277851 12:119728250-119728272 CCAAATGCATAGTTTAAATTAGG - Intronic
1103994826 12:124822243-124822265 ATATATCCATATTTGATAGTTGG + Intronic
1106977857 13:35243816-35243838 CTTTATCCATTACTGAAATTGGG - Intronic
1107640443 13:42437704-42437726 CAAAGTCCATAGTTTAAATTAGG + Intergenic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1111511112 13:89264026-89264048 CTAAGTCCATAGTTTACATTAGG + Intergenic
1111522370 13:89423215-89423237 CCATTTCCATATTTAAAATTGGG + Intergenic
1112953095 13:105026720-105026742 TTCTATCCATTATTGAAATTGGG + Intergenic
1114129111 14:19768898-19768920 ATTTATCCATTGTTGAAAATTGG + Intronic
1114173159 14:20295047-20295069 CTATATCCATAGTTGAAATTTGG - Intronic
1114845516 14:26315792-26315814 CTATATCGCTCATTGAAATTAGG - Intergenic
1114968565 14:27997160-27997182 ATATATCAATAATTGAATTTAGG + Intergenic
1116192441 14:41678464-41678486 TTATATCCATTATTGAAAATGGG - Intronic
1116682796 14:47995960-47995982 CATTATCCTTTGTTGAAATTTGG - Intergenic
1117063283 14:51984064-51984086 CTATAAAAATAGTTGAGATTGGG - Intergenic
1118117125 14:62791840-62791862 ATCTATCCATTGTTGAAAGTGGG - Intronic
1118133534 14:62995478-62995500 GTTTATCCAATGTTGAAATTTGG - Intronic
1119792308 14:77363042-77363064 ATGTATCCATTGTTGAAAATGGG - Intronic
1119835555 14:77746860-77746882 CTAAATCCATAATAAAAATTTGG + Intronic
1120467378 14:84877023-84877045 ATAAATCCATGGTTGAATTTTGG - Intergenic
1120690108 14:87582870-87582892 TAAAATCCATAGTTGACATTAGG - Intergenic
1127298518 15:57630663-57630685 GTCTATCCACAGTTTAAATTTGG - Intronic
1129130891 15:73494161-73494183 CTATATCAATACTAGAAACTAGG - Intronic
1130731704 15:86500376-86500398 CTATTTCCATACTAGAACTTGGG - Intronic
1131391887 15:92056458-92056480 CTATATCCATCCTTAAAAATAGG + Intronic
1131710511 15:95049936-95049958 ATATATTCATTGTTGAAAGTGGG - Intergenic
1131743853 15:95423424-95423446 CAAAGTCCACAGTTGAAATTAGG - Intergenic
1133667379 16:7982113-7982135 CCATATCAGTTGTTGAAATTAGG + Intergenic
1135800590 16:25490503-25490525 CATTATCCATAGTTTACATTAGG + Intergenic
1137906591 16:52328950-52328972 CTATATTTATAAATGAAATTAGG + Intergenic
1138218729 16:55230347-55230369 CTATATTCATATGTGAGATTGGG - Intergenic
1138427481 16:56945758-56945780 CTATAGCCAGAGCTGAAATCTGG - Intergenic
1138783509 16:59817177-59817199 ATCTCTCCATAGTTGAAAGTAGG - Intergenic
1138890568 16:61139387-61139409 CTATATCCAATGTTGTCATTTGG - Intergenic
1140583458 16:76257882-76257904 GTTTATTCATAGTTGAAACTAGG + Intergenic
1141211924 16:81989355-81989377 ATATATACATATATGAAATTTGG + Exonic
1144014852 17:11184320-11184342 CTGTATTCATAGTTGAAGTGGGG - Intergenic
1146091122 17:29879173-29879195 CAATATTCTTAGTTTAAATTAGG - Intronic
1146352085 17:32103482-32103504 CTATTTCCCCAGTTCAAATTAGG + Intergenic
1149869599 17:60169848-60169870 CTATTTCCCCAGTTCAAATTAGG + Intronic
1153714048 18:7827785-7827807 ATATATCCATAGTGGACATGTGG + Intronic
1153950285 18:10052687-10052709 CTATTTCCACATTTAAAATTTGG - Intergenic
1154239149 18:12636240-12636262 CTAAATGCATATTTGAATTTAGG - Intronic
1154373618 18:13790181-13790203 ATCTATCCATTATTGAAATTGGG + Intergenic
1155577281 18:27261181-27261203 TTCTATCCATTATTGAAATTGGG + Intergenic
1156130281 18:33964669-33964691 CTACATCCAAAGTTGATCTTGGG - Intronic
1156145974 18:34178763-34178785 TTCTATCCATTTTTGAAATTGGG - Intronic
1159538219 18:69742057-69742079 ATATATCCATAGTCTGAATTAGG + Intronic
1159715063 18:71811422-71811444 CAAAATCCATAGTTTACATTGGG - Intergenic
1166610393 19:44188194-44188216 TTCTATCCATAATTGAAAGTGGG + Intergenic
1168586370 19:57596865-57596887 CCAAATCCATAGTTTACATTAGG - Intergenic
926543620 2:14210965-14210987 CTGTCTCCATAGTAGAAATAAGG + Intergenic
926706260 2:15839928-15839950 TTATTTCCATGGTTTAAATTGGG - Intergenic
928608367 2:32965341-32965363 CAATGTCCATAGTTTATATTAGG + Intronic
929963156 2:46511469-46511491 ATACATCCAAAGTTGAAATTAGG + Intronic
930235966 2:48889294-48889316 CTATATTCATTGTTGGAATAAGG - Intergenic
931207508 2:60162427-60162449 TTTTATCCATATTTAAAATTGGG + Intergenic
932834901 2:75027177-75027199 ATTTATACAAAGTTGAAATTAGG + Intergenic
933312786 2:80681604-80681626 CTATTTTTATAGTTGTAATTTGG - Intergenic
933474267 2:82768857-82768879 TTCTATCCTTTGTTGAAATTGGG - Intergenic
934625320 2:95844114-95844136 ATCTTTCCATGGTTGAAATTGGG - Intronic
935687220 2:105695053-105695075 CTGGATCCATACTTAAAATTAGG + Intergenic
935750081 2:106224394-106224416 CTGAATCCATAATTTAAATTAGG + Intergenic
938722907 2:134082145-134082167 CAAAATCCATAGTTTACATTAGG + Intergenic
938823954 2:134986198-134986220 CTAGATCATTAGTTAAAATTCGG + Exonic
939222043 2:139314830-139314852 CTATATCCTTAGTCCACATTTGG + Intergenic
939269236 2:139916398-139916420 CTAAATCTATAGTTCAATTTTGG - Intergenic
939321285 2:140626350-140626372 CAAAATCCATAATTTAAATTAGG - Intronic
939796524 2:146652063-146652085 CAAAATCCATAGTTTATATTAGG - Intergenic
939921372 2:148118442-148118464 ATATATATATAGTTTAAATTAGG + Intronic
940206526 2:151208751-151208773 CTATATTTATAGATGAATTTAGG - Intergenic
941936467 2:170985273-170985295 CTATATTCAGAGATAAAATTTGG - Intergenic
943002584 2:182347317-182347339 TTAGACTCATAGTTGAAATTAGG - Intronic
943993079 2:194722116-194722138 CTAAGTCCATAGTTTACATTAGG - Intergenic
944207939 2:197176499-197176521 CTATACTCATAGTTGTATTTTGG + Intronic
944641992 2:201737165-201737187 CTATATAAATAGTTGTAATATGG - Intronic
944821464 2:203436552-203436574 AATTATCCATAGTAGAAATTAGG + Exonic
946108603 2:217393905-217393927 CTCTATCCATATTTGGAAGTTGG - Intronic
947921225 2:233876135-233876157 CGATGTCCATAGTTTACATTAGG + Intergenic
1168752020 20:289419-289441 CTATATCAATACTTGCAATTTGG + Intronic
1168867365 20:1099112-1099134 CTAAAGCCATAGTTTACATTAGG - Intergenic
1169597802 20:7220900-7220922 CTGAATCCATATTTGAAATTAGG + Intergenic
1170178850 20:13505328-13505350 ATCTATCCATTGTTGAAAGTGGG - Intronic
1170722495 20:18896077-18896099 CAAAATCCATAGTTTACATTAGG - Intergenic
1170867536 20:20172798-20172820 CAATGTCCATAGTTCACATTAGG + Intronic
1173675891 20:44835435-44835457 CTATAGCCCTAGTTGAGAGTGGG + Intergenic
1177351758 21:19952119-19952141 CTATATCTTTAGTTGTAATTGGG + Intergenic
1180628346 22:17209576-17209598 CTCTATCCATAGATGAAACACGG - Exonic
1180893371 22:19308468-19308490 CTATACCTATCATTGAAATTTGG + Intergenic
1182056536 22:27359969-27359991 CAATGTCCATAGTTTACATTAGG + Intergenic
951837387 3:26998206-26998228 CTATATCCTGTGTTCAAATTGGG - Intergenic
952537806 3:34332089-34332111 ATCTGTCCATAGTTGAAAGTTGG + Intergenic
955035933 3:55267766-55267788 CTCTATCCCTACTTTAAATTTGG + Intergenic
956083524 3:65585333-65585355 CTTTATCCACATTTAAAATTGGG - Intronic
956305277 3:67817278-67817300 CAAAATCCATTGTTGAATTTGGG - Intergenic
956956742 3:74350036-74350058 TTAGATCCATATTTCAAATTTGG - Intronic
957166620 3:76682220-76682242 CTGAGTCCATAGTTGATATTAGG - Intronic
957208053 3:77223587-77223609 ATAGATTCATAATTGAAATTTGG + Intronic
958743712 3:98108394-98108416 CTCTATCCATTGTTGGAAGTTGG + Intergenic
959011438 3:101081531-101081553 CAAAATCCATAGTTTATATTAGG - Intergenic
959110838 3:102120815-102120837 ATATATCCATTGTTGAAAGTAGG + Intronic
959918226 3:111842442-111842464 CAAAATCCATAGTTTACATTAGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960505973 3:118494452-118494474 ATATGTCTATAGGTGAAATTTGG + Intergenic
960618879 3:119620554-119620576 CTATATCCTTATGTGAAAATGGG + Intronic
960834116 3:121886796-121886818 CTAAGTCCATAGTTTACATTAGG + Intergenic
960841931 3:121967900-121967922 CAAAATCCATAGTTTACATTAGG + Intergenic
962116498 3:132514846-132514868 CTATGTCAAAAGTTGAAAGTTGG + Intronic
962361188 3:134744117-134744139 CCCTATCCATAATTGAGATTTGG + Intronic
962875586 3:139533838-139533860 TCATATCCATCGTTGAACTTAGG - Intronic
963813769 3:149807505-149807527 ATCTATCCATTGTTGAAAGTGGG + Intronic
963978235 3:151506904-151506926 CTATATGCATATGTGATATTTGG + Intergenic
965269269 3:166591745-166591767 CTAAATCCATAGTTTACATTAGG + Intergenic
965444714 3:168761038-168761060 ATCTATCCATTGTTGAAAGTTGG + Intergenic
966423712 3:179758903-179758925 CTATAACCACTGTTGACATTTGG + Intronic
966677038 3:182600749-182600771 CTATCTTCTGAGTTGAAATTCGG - Intergenic
967430371 3:189377593-189377615 TTAAATCCATAGATGAAGTTGGG + Intergenic
967709664 3:192691102-192691124 ATCTATCCATTGTTGAAAGTGGG - Intronic
968437987 4:604960-604982 CTATGTCCTTATTTAAAATTGGG - Intergenic
968499407 4:940618-940640 CTAAGTCCATAGTTTACATTAGG - Intronic
970208833 4:13685535-13685557 ATATATCCATTGCTGAAAATGGG + Intergenic
971078722 4:23181667-23181689 CTTTATTCATAATTGAAATTTGG - Intergenic
971189229 4:24411529-24411551 CAAAATCCATAGTTCACATTAGG + Intergenic
971667083 4:29501640-29501662 ATATAACCACTGTTGAAATTTGG + Intergenic
972020416 4:34306437-34306459 TTATTTCCATAGATGAAATAAGG + Intergenic
972143500 4:35991028-35991050 CTGTATCTATTGTTGAAAGTGGG - Intronic
972361061 4:38325779-38325801 CGATATCACTATTTGAAATTTGG - Intergenic
973144605 4:46809820-46809842 ATATATCCATTGTTGAAAGTGGG + Intronic
974930383 4:68354541-68354563 CCAAATCTATAGATGAAATTAGG - Intergenic
977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG + Intronic
977946135 4:102916501-102916523 TTGTATCCATAATTGAAAGTGGG - Intronic
979130255 4:117035896-117035918 CTATATTCAACTTTGAAATTCGG + Intergenic
979173082 4:117626206-117626228 ATAAATCAATAATTGAAATTTGG + Intergenic
979371953 4:119899671-119899693 CTCTATCAATAATTCAAATTGGG - Intergenic
979745106 4:124203341-124203363 CTATATTCTCAGTTTAAATTGGG + Intergenic
980288987 4:130820717-130820739 CTAAGTCCATAGTTGACATTAGG + Intergenic
980571037 4:134620624-134620646 TGATATCCATGTTTGAAATTAGG + Intergenic
982034666 4:151333979-151334001 CTATATAAACAGGTGAAATTTGG - Intergenic
982785788 4:159534886-159534908 CTCTGTCCATTGTTGAAAGTGGG + Intergenic
982891598 4:160859344-160859366 GTAAATCCATTGTTTAAATTTGG + Intergenic
983004986 4:162473424-162473446 ATATCTCCATAATTGTAATTAGG - Intergenic
984624747 4:181994252-181994274 CTATATAGATAATTCAAATTGGG + Intergenic
985022960 4:185711407-185711429 CTCTAGCCCTAGTTGAACTTGGG - Intronic
985893550 5:2735469-2735491 CTATATCCATGGTTTATATTAGG - Intergenic
986669884 5:10133357-10133379 CAAAATCCATGGTTTAAATTAGG + Intergenic
986973543 5:13367539-13367561 CCAAATCCATAGTTTACATTAGG - Intergenic
987517502 5:18932112-18932134 CTAAATCCATAGTAAAAGTTAGG - Intergenic
988642228 5:33052792-33052814 ATATATCCAATGTTGAAAGTGGG - Intergenic
988647119 5:33107064-33107086 ATCTATCCATTGTTGAAAGTGGG + Intergenic
988670073 5:33371739-33371761 CTATTTACATAGTTGTAACTTGG - Intergenic
988881333 5:35506868-35506890 CTCTATCCATTATTGAAAGTGGG - Intergenic
988892511 5:35633207-35633229 CTGTATCCATTATTGAAAGTTGG + Intronic
989282668 5:39664003-39664025 CTATCTCCATAAAGGAAATTGGG + Intergenic
990173605 5:53082684-53082706 CAAAATCCATAGTTTACATTAGG + Intronic
991135685 5:63179436-63179458 CTATATTGAAAGTTGAAGTTGGG + Intergenic
991508147 5:67346597-67346619 GTCTATCCATTGTTGAAAGTGGG - Intergenic
992132855 5:73711392-73711414 TTATATCTATAGATCAAATTGGG + Intronic
992849527 5:80792931-80792953 TTAAAGCCAAAGTTGAAATTTGG - Intronic
993351465 5:86855314-86855336 CAAAATCCAGAGTGGAAATTGGG + Intergenic
994575777 5:101577315-101577337 CTAAATCCTTAGTTAAAATGTGG + Intergenic
994657445 5:102611325-102611347 CTAAATCAAGATTTGAAATTTGG - Intergenic
994977326 5:106826925-106826947 CTATATGCATTGTTGGAATTAGG - Intergenic
995012945 5:107278002-107278024 CTATATTCTGAGTTGAAATGTGG + Intergenic
995029699 5:107466211-107466233 CTAAATCCACAGTGGAACTTTGG - Intronic
995210463 5:109531795-109531817 TTATATCAATATTTGAAGTTGGG + Intergenic
995280338 5:110328328-110328350 ATCTATCCATTGTTGAAAGTGGG + Intronic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
998571955 5:143268510-143268532 TTGAATCCATAGTTCAAATTGGG + Intergenic
999421285 5:151446838-151446860 CTCTATCCATTGTTGAAAGTGGG + Intronic
999695357 5:154184067-154184089 CAAAATCCATAGTTTACATTAGG - Intronic
1000580389 5:163028537-163028559 CAAAATCCATAGTTTACATTAGG + Intergenic
1002390537 5:178908470-178908492 CTATTTACATGGTTGAAATTAGG - Intronic
1004799163 6:19126935-19126957 CCAAATCCATAGTTTACATTAGG - Intergenic
1005484138 6:26283672-26283694 TTATATACTTAGTTGAAATCAGG - Intergenic
1011366651 6:86589401-86589423 CCATATCCTTAGTTGAAAAATGG + Intergenic
1014146761 6:118007071-118007093 TTATAACAATACTTGAAATTGGG + Intronic
1014324281 6:119972470-119972492 CAAAATCCATAGTTTACATTAGG - Intergenic
1014459606 6:121680529-121680551 CTATATCTTGAGTTGAAACTAGG - Intergenic
1015789270 6:136950246-136950268 CAAAATCCATAGTTTACATTAGG - Intergenic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1020774726 7:12438713-12438735 CTAAATTCATAGGTGAATTTTGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1026922793 7:74168786-74168808 ATATATCTATATCTGAAATTGGG - Intergenic
1027240149 7:76321978-76322000 AAATATAGATAGTTGAAATTTGG - Intergenic
1027982825 7:85248959-85248981 CAATGTCCATAGTTTACATTTGG - Intergenic
1028556062 7:92126241-92126263 CTTTATCCATACCTGAAACTAGG + Exonic
1028626017 7:92878109-92878131 ATGTGTCCATTGTTGAAATTGGG - Intergenic
1028995116 7:97091385-97091407 CAAAATCCATAGTTTATATTAGG + Intergenic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1035091272 7:156313856-156313878 ATCTATCCATTGTTGAAAGTGGG + Intergenic
1037935207 8:22910924-22910946 CCAAATCCATAGTTCACATTAGG - Intronic
1038100556 8:24369501-24369523 CAATGCCCATAGTTTAAATTAGG + Intergenic
1038469138 8:27797160-27797182 ATGTATCCATTGTTGAAAGTAGG + Intronic
1039665278 8:39519195-39519217 ATCTATCCATGGTTGAAACTGGG + Intergenic
1040556535 8:48483914-48483936 TTATATCCATCATTGAAAGTGGG + Intergenic
1041506151 8:58600044-58600066 CTATTTCCTTAGCTGAAAATAGG - Intronic
1041557590 8:59175294-59175316 CTATATCCTGTGTTGAATTTAGG + Intergenic
1043308425 8:78826649-78826671 ATCTATCCATTGTTGAAAGTGGG - Intergenic
1043372516 8:79611467-79611489 CTGTTTCCATATTTAAAATTAGG + Intronic
1043505939 8:80902699-80902721 CTCTATCCATTATTGAAAATTGG - Intergenic
1045073340 8:98534733-98534755 CTATATTCAGAATTGAAACTCGG + Intronic
1045598114 8:103680611-103680633 ATATATACATAGTTGAACATAGG - Intronic
1051288173 9:15517466-15517488 CAATGTCCATAGTTTACATTAGG + Intergenic
1052582053 9:30370594-30370616 ATATGTCCATTGTTGAAAATGGG + Intergenic
1052780187 9:32774286-32774308 ATATATCCATTGTTGAAAATGGG + Intergenic
1055176948 9:73331188-73331210 ATCTATCCATTGCTGAAATTGGG + Intergenic
1055645079 9:78355633-78355655 CTATATCTATGGTATAAATTGGG - Intergenic
1055984737 9:82046151-82046173 ATCTATCCATTGTTGAAAGTGGG + Intergenic
1057116713 9:92530265-92530287 CAATGTCCATAGTTTACATTAGG - Intronic
1058071664 9:100607567-100607589 CAATGTCCATAGTTTATATTAGG - Intergenic
1059067202 9:111097997-111098019 CAATGTCCATAGTTTACATTAGG + Intergenic
1059933497 9:119284440-119284462 CTATATCCATTTTTAAAATGAGG - Intronic
1060169407 9:121448828-121448850 CAACATCCATAGTTTACATTAGG + Intergenic
1060714988 9:125917390-125917412 CAAAATCCATAGTTTACATTAGG + Intronic
1186492535 X:9985396-9985418 CAGAATCCATAGTTGACATTAGG - Intergenic
1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG + Intronic
1187831466 X:23386765-23386787 TTATTTCCATATATGAAATTTGG + Intronic
1188082672 X:25863248-25863270 ATCTATCCATTGTTGAAAATTGG - Intergenic
1188725718 X:33579247-33579269 ATTTGTCCATTGTTGAAATTGGG + Intergenic
1189091070 X:38083442-38083464 CTATTTCTATAGTTAACATTAGG + Intronic
1189927045 X:45966783-45966805 CTCTCTCCATTGTTGAAAGTGGG + Intergenic
1190540884 X:51477339-51477361 CTAAATGCAAAGGTGAAATTTGG - Intergenic
1192686031 X:73306081-73306103 CTATGTCCATTGTTGATAGTGGG - Intergenic
1193533778 X:82687813-82687835 ATTTATCCATTGTTGAAAGTGGG + Intergenic
1193767782 X:85551934-85551956 CTTTGTCCATTTTTGAAATTAGG + Intergenic
1193897947 X:87136936-87136958 ATATATCCATGGTTCAAATTTGG - Intergenic
1194188202 X:90800692-90800714 CCATATCAATAGTTTACATTAGG + Intergenic
1194424429 X:93718980-93719002 CAAAATCCATAGTTTACATTAGG + Intergenic
1196020896 X:110989949-110989971 CAATATCCTCAGTTGAGATTGGG - Intronic
1196278802 X:113798922-113798944 GTATATACATATTTGTAATTTGG + Intergenic
1196381407 X:115094303-115094325 GTCTATCCATGGTTGAAAATGGG - Intergenic
1196485113 X:116197418-116197440 CTATTTCTATAGTTCAGATTAGG - Intergenic
1196840054 X:119851648-119851670 ATATATGCATACTTGTAATTGGG - Intronic
1199029345 X:142978371-142978393 CTATATATAGAATTGAAATTAGG - Intergenic
1202251894 Y:22881571-22881593 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202404882 Y:24515320-24515342 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202465897 Y:25154762-25154784 CTCTGTCCAAAGGTGAAATTGGG + Intergenic