ID: 1114177530

View in Genome Browser
Species Human (GRCh38)
Location 14:20336416-20336438
Sequence CTACTAAGGTAGGCTGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114177524_1114177530 -8 Left 1114177524 14:20336401-20336423 CCTCTATAGTCCCAGCTACTAAG No data
Right 1114177530 14:20336416-20336438 CTACTAAGGTAGGCTGAGTCGGG No data
1114177523_1114177530 7 Left 1114177523 14:20336386-20336408 CCAAGAGTGGTGATGCCTCTATA No data
Right 1114177530 14:20336416-20336438 CTACTAAGGTAGGCTGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114177530 Original CRISPR CTACTAAGGTAGGCTGAGTC GGG Intergenic
No off target data available for this crispr