ID: 1114179840

View in Genome Browser
Species Human (GRCh38)
Location 14:20356875-20356897
Sequence CTCAGAAGGCGGAAATTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114179833_1114179840 -1 Left 1114179833 14:20356853-20356875 CCTAAAGATACCTCACCTTTCCC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 105
1114179831_1114179840 16 Left 1114179831 14:20356836-20356858 CCCTCTTTCTTTAAATTCCTAAA 0: 1
1: 0
2: 4
3: 63
4: 728
Right 1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 105
1114179832_1114179840 15 Left 1114179832 14:20356837-20356859 CCTCTTTCTTTAAATTCCTAAAG 0: 1
1: 1
2: 5
3: 36
4: 419
Right 1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114179840 Original CRISPR CTCAGAAGGCGGAAATTCAC AGG Intronic
904066765 1:27758312-27758334 CTAGGAAGGTGGAAATTCATGGG + Intronic
904499599 1:30906646-30906668 CTCAGAGGGCAAAAATTCAATGG - Intronic
908058437 1:60319203-60319225 CTCATCAGGTGGTAATTCACAGG - Intergenic
910369270 1:86498731-86498753 ACCTGAAGGCGGAAATTCACGGG + Exonic
911011249 1:93283125-93283147 CTAAGAAGGCTAGAATTCACAGG + Intergenic
913526633 1:119700043-119700065 CTCAGGAGACAGAAATTAACTGG - Intronic
917372836 1:174314325-174314347 CTGAGATGGCAGAAATTCAAAGG - Intronic
921909396 1:220529747-220529769 TTCAGAAGGTGGAAATACAAGGG - Intronic
924902625 1:248417830-248417852 GACAGAAGACGGAAACTCACAGG + Intergenic
1064869969 10:19926461-19926483 GTCAGCAGGCGGAAATTCACGGG + Intronic
1064875167 10:19985824-19985846 CTAAGGAGGTGGAAAGTCACTGG - Intronic
1065848439 10:29765913-29765935 TTCACATGGCGGAAATTCCCAGG + Intergenic
1070565752 10:77602790-77602812 CTCAGAACCCCGAAATCCACGGG - Intronic
1080819574 11:35792586-35792608 CCCAGAAGGAGGGATTTCACTGG - Intronic
1080862732 11:36163857-36163879 CTCAAATGGTGGAAGTTCACTGG + Intronic
1081111812 11:39144913-39144935 TTCAGCAGGCAGAAATTGACAGG - Intergenic
1086876641 11:92104465-92104487 CTCACAAGTCTGAAATCCACAGG + Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1091503689 12:1044087-1044109 CTGATAAGCCTGAAATTCACTGG + Intronic
1093344390 12:18023479-18023501 CTGAGAAGAAGGAAATTCAGAGG - Intergenic
1094720085 12:33054063-33054085 CTCTGACGGCGGATTTTCACTGG - Intergenic
1096186394 12:49584447-49584469 CTCAGAAGGTTGAGAATCACTGG + Intronic
1100075818 12:90781501-90781523 TTCAGAAGGTTGAAACTCACTGG - Intergenic
1102688820 12:114744514-114744536 CTCATATGGCAAAAATTCACAGG + Intergenic
1106478237 13:30116139-30116161 CTTAGATGGCTGAAATTCCCAGG - Intergenic
1108985557 13:56582109-56582131 ATCAGAAGACGGAAATTAAATGG - Intergenic
1109749763 13:66673609-66673631 CTCAGAAGGCAGAAACTCTGTGG + Intronic
1112278968 13:98046107-98046129 CTCAGAATCAGTAAATTCACAGG + Intergenic
1114179840 14:20356875-20356897 CTCAGAAGGCGGAAATTCACAGG + Intronic
1115999653 14:39229271-39229293 CTCAGAAGCTGGTGATTCACAGG - Intergenic
1116516419 14:45812188-45812210 CTCACTAGGAGTAAATTCACAGG - Intergenic
1121242387 14:92440127-92440149 CCCAGCAGGGGGAAAGTCACGGG - Intronic
1121752389 14:96368512-96368534 CTCAGAAGAAAGAAATACACAGG - Intronic
1123677365 15:22724055-22724077 TTCAGAAGGTGGAAATTCTTGGG - Intergenic
1124329577 15:28798325-28798347 TTCAGAAGGTGGAAATTCTTGGG - Intergenic
1125283581 15:38069488-38069510 ATCAGAAGCCGGAAATTATCTGG - Intergenic
1129118444 15:73379777-73379799 CCATGAAGGCGGAAATTCAGTGG - Intergenic
1133688368 16:8188880-8188902 CTGAGAAGGCTGAATTGCACCGG - Intergenic
1139077688 16:63473368-63473390 CTCAGAAGGAGTGAATTCAATGG - Intergenic
1139583079 16:67884718-67884740 CTCAGAGAGCAGAAATTCGCAGG - Intergenic
1140875144 16:79144003-79144025 CTCAGTAAGCTGAAAATCACTGG - Intronic
1142520514 17:501448-501470 GGCAGAAGGCAGAAAGTCACAGG + Intergenic
1149168302 17:53780235-53780257 CTCAGCAGTCTGAAATCCACCGG + Intergenic
1153995725 18:10440009-10440031 CTCAGAAGGAGGAAACTGGCAGG - Intergenic
1156796951 18:41057624-41057646 TTCAGAAGGCTGAAGGTCACTGG - Intergenic
1159316088 18:66775511-66775533 TTCAGAAGGAGGAAAGTCATTGG - Intergenic
1159510914 18:69397416-69397438 CTAAGAAGGAGGAATTACACAGG + Intergenic
1160133465 18:76250667-76250689 CTGAGAAGAAGGAAATTCACTGG + Intergenic
1161627557 19:5336088-5336110 CTCCAAAGGCGAAAATTAACGGG - Intronic
1168396771 19:56055073-56055095 CTCGGAAGGCGGAGATTCCAGGG - Intronic
927581055 2:24247876-24247898 ATCAGAAGGTGGAATTTCAGGGG + Intronic
928319037 2:30268651-30268673 CTAAGAAGGGGGAAAGTCCCAGG + Intronic
930544361 2:52747635-52747657 CTCAAAAGGCAGAAGTTCAGAGG + Intergenic
933581216 2:84129070-84129092 CCCCGAAGGCAGAACTTCACTGG - Intergenic
933598652 2:84307732-84307754 CTAAGAAGGAGAAAAGTCACTGG + Intergenic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
1170188252 20:13617015-13617037 TTCAGAAGGTGGAAATTCTTGGG + Intronic
1172807879 20:37625890-37625912 CTAACAAGGCAGAAATTCATAGG - Intergenic
1172922350 20:38495799-38495821 TTCAGAAGGCCTAAATTCAGAGG - Intronic
1174609899 20:51790476-51790498 CTCAGAACCCGTAAAGTCACAGG + Exonic
1178613244 21:34106378-34106400 ATTAGTAGGGGGAAATTCACTGG - Intronic
1179786345 21:43732327-43732349 CTCAGAAGACGACAATGCACGGG - Intronic
953285517 3:41603198-41603220 TTCAGAGGGAGGAAATTAACAGG + Intronic
953532732 3:43752796-43752818 CTCAGAAGGCAGAAAGGCAAGGG + Intergenic
953806021 3:46067843-46067865 CTCAGGAGGCAGAAAATCTCAGG + Intergenic
955732639 3:62003412-62003434 CTGAGAAGGTGGAATTTCACTGG + Exonic
958918520 3:100076570-100076592 CTCAGAAGACTGACATTCAGTGG - Intronic
959287906 3:104440161-104440183 GTCAGGAGAAGGAAATTCACAGG + Intergenic
959288724 3:104445575-104445597 GTCAGGAGAAGGAAATTCACAGG + Intergenic
959321117 3:104876938-104876960 CTCAGATGCCTGCAATTCACTGG + Intergenic
959782208 3:110247875-110247897 CTTAGAAGGCAAAAATTCAATGG + Intergenic
960310521 3:116111028-116111050 GCCAGAAGAAGGAAATTCACAGG + Intronic
960721537 3:120628861-120628883 CTCAGAAGATGGATATTCCCAGG - Intronic
961288994 3:125830165-125830187 CTGAGATGGGGGAAAATCACTGG - Intergenic
970883362 4:20958248-20958270 CTCTGAAAGAGGAACTTCACTGG - Intronic
971243839 4:24911938-24911960 CTCAGAAGGGAGAAATTCCCCGG + Intronic
971825905 4:31622375-31622397 CTCAGAAGGCAGAATTATACTGG - Intergenic
976632143 4:87249956-87249978 ATCAAAAAGCTGAAATTCACAGG + Intergenic
980913870 4:139016453-139016475 CTCGGAAGGGGGAAATTTAACGG - Intronic
983000122 4:162403971-162403993 CTCAAAAGGCAGAAATTAATGGG + Intergenic
983346422 4:166531821-166531843 CACAGAAGACGGAAAATAACAGG - Intergenic
985897537 5:2757748-2757770 CTGAGAATGCGCACATTCACTGG + Intergenic
990886695 5:60602442-60602464 CTCAGAAGGAGGCAGTTCACTGG + Intronic
994143808 5:96370558-96370580 CACAGAAAACTGAAATTCACAGG + Intergenic
994947045 5:106408713-106408735 CACAGAAAGAGGAACTTCACAGG - Intergenic
1001232217 5:169998327-169998349 CTCAGAAGGGTGAATCTCACAGG - Intronic
1005144963 6:22679143-22679165 CACAGAAGGCTGAAATTTATGGG + Intergenic
1007027412 6:38590819-38590841 CTAAGAAGCCAGAAATTCTCAGG - Intronic
1008643024 6:53484117-53484139 CTCAGGAGGAGGAAGTTCATTGG - Intergenic
1011087072 6:83552918-83552940 CTCAGAGGGCGTACATGCACTGG + Exonic
1013213091 6:108004035-108004057 TTTACAAAGCGGAAATTCACTGG + Intergenic
1014510686 6:122317786-122317808 CTCAAAAGGCTGAAATTAAGAGG - Intergenic
1014654072 6:124077427-124077449 CTCAGAAGGAGCAACTTCACTGG + Intronic
1016217751 6:141623881-141623903 TTCAGAAGGGGGAAAGTAACAGG - Intergenic
1018231534 6:161680414-161680436 CTCAGAACTCGGCCATTCACAGG - Intronic
1021140715 7:17021361-17021383 CTCAGAAGGCGAAAGTCCAGCGG + Intergenic
1022804503 7:33808012-33808034 CACAGGAGGCTGAAAATCACTGG - Intergenic
1028646261 7:93100164-93100186 TCCAGAAAGGGGAAATTCACAGG - Exonic
1033577334 7:142698200-142698222 CTCATAAGGCGGAAATCAAGGGG + Intergenic
1033675497 7:143537465-143537487 GCCAGAAGAAGGAAATTCACAGG + Intergenic
1033981436 7:147170559-147170581 CTCAGAAGGGTGAGATGCACAGG - Intronic
1034742468 7:153489927-153489949 CTCAGACTGCAGAAATTAACAGG + Intergenic
1035394742 7:158527508-158527530 CTCAGAAGGAGGAAATGGAGAGG - Intronic
1037748327 8:21663625-21663647 CCCAGAAGGCAGAAATACAGTGG + Intergenic
1039802630 8:40973185-40973207 CTCACAAGTCTGAAATTCACAGG + Intergenic
1045946336 8:107801157-107801179 CTAAGAAGGCGAAAATACACTGG - Intergenic
1054966339 9:71031647-71031669 CTCAGAAGTGGGAAATTCTGTGG - Intronic
1060445359 9:123682101-123682123 CTGATAAGGCTGAAATCCACTGG - Intronic
1186025802 X:5309944-5309966 CTCAGAAAACTGAAATTCAAAGG - Intergenic
1190592287 X:52016508-52016530 ATCTGAAGACAGAAATTCACAGG + Intergenic
1192798420 X:74443619-74443641 CTCAGGAGGCGGAGAGTTACAGG - Intronic
1194308090 X:92273316-92273338 GCCAGAAGAAGGAAATTCACAGG + Intronic
1194618194 X:96133920-96133942 CCCAGAAGGCTGAAATTCTTTGG + Intergenic
1195479012 X:105321285-105321307 CTCAGAGAGGGGAAATTTACTGG + Intronic
1199078097 X:143546963-143546985 CTCAGAAGGGGGAAGGTCAGAGG + Intergenic