ID: 1114181102

View in Genome Browser
Species Human (GRCh38)
Location 14:20368736-20368758
Sequence TCCCTTTGGGATAGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114181098_1114181102 10 Left 1114181098 14:20368703-20368725 CCTTTCTTACTCTAAGTTTGCTG 0: 1
1: 0
2: 3
3: 21
4: 235
Right 1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 159
1114181097_1114181102 11 Left 1114181097 14:20368702-20368724 CCCTTTCTTACTCTAAGTTTGCT 0: 1
1: 1
2: 0
3: 39
4: 346
Right 1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114181102 Original CRISPR TCCCTTTGGGATAGGTGTGC AGG Intronic
901541196 1:9917800-9917822 TGCCTTTTGGCTAGGTGTGGTGG - Intergenic
903222328 1:21875827-21875849 TCCCCTGGGGGTAGGGGTGCGGG - Intronic
903332513 1:22603187-22603209 TCCCCGCGGGATAGCTGTGCTGG - Exonic
904591979 1:31620049-31620071 CCCCTTTGGGATTGGGGAGCAGG - Intronic
908276390 1:62476782-62476804 TACCTTTGGGATAGCAGTGGGGG - Intronic
909627855 1:77738765-77738787 TCCCTTTGGGCTGGGTGCGGTGG - Intronic
910563172 1:88614512-88614534 TCCTTTTGTGATAGGCTTGCCGG + Intergenic
910707765 1:90147973-90147995 TCCTTTTGGGAAAGGTTTGAAGG + Intergenic
911327493 1:96485503-96485525 TCCCTTTGGGTTTGGGGTGTGGG + Intergenic
913401945 1:118445733-118445755 TTCCTTTAGGGTAGGTATGCTGG - Intergenic
914314353 1:146495734-146495756 TCTCTTAGGGAAGGGTGTGCAGG + Intergenic
914499996 1:148237647-148237669 TCTCTTAGGGAAGGGTGTGCAGG - Intergenic
914591283 1:149108158-149108180 TCTCTTAGGGAAGGGTGTGCAGG + Intergenic
919676365 1:200387419-200387441 TCCTTTTGGGCTGGGTGTGGTGG - Intergenic
919804436 1:201372762-201372784 TCCCTCTGGGATAGGACTGTGGG + Intronic
922692019 1:227700515-227700537 TCCCTTTGCTGTAGGTCTGCTGG - Intergenic
1064158533 10:12923635-12923657 TTCCTTTGGGATATGCGTCCCGG + Intronic
1064839893 10:19579783-19579805 TTCCTTTGGGAAATGTGTGCTGG + Intronic
1065047406 10:21756943-21756965 TCCCTTTGGGCTGGGCTTGCAGG - Intronic
1066153507 10:32650533-32650555 TCCCTTAGGGAGAGGTCTGATGG + Intronic
1074875196 10:117608109-117608131 ACCCTTGGGGCTAGGTGTGGTGG + Intergenic
1075496764 10:122927977-122927999 TGCCTATGGGATAGCTCTGCTGG + Intergenic
1076010742 10:126986129-126986151 ACCCTTTGGGCTGGGTGTGGTGG - Intronic
1078275373 11:9839947-9839969 TCCTTTTGGGCTGGGTGTGGTGG + Intronic
1080539998 11:33256857-33256879 ACTCTTTGGGATAGGGGAGCGGG + Intronic
1081699880 11:45146468-45146490 TCCCTTTGGGTTTGGAGAGCCGG + Intronic
1084691272 11:70728294-70728316 TCCCTCTGGGATATGTGAGAAGG + Intronic
1084919079 11:72454589-72454611 GGCCTTTGGGATAGTGGTGCTGG - Intergenic
1085103552 11:73822284-73822306 TGCCTTTGGGGTGGGGGTGCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1087038300 11:93774858-93774880 TCCCTTTTGGCTGGGTGTGGTGG + Intronic
1092272429 12:7033817-7033839 TCCCTTTGAGCTAGGTGAGGCGG - Intronic
1092439372 12:8484339-8484361 ACCCTTTGGGCTGGGTGTGGTGG - Intergenic
1097024031 12:56040966-56040988 TACCCTTGTCATAGGTGTGCTGG - Intergenic
1099538640 12:83876881-83876903 TCCCTTTGGGGAAGGTTTGTGGG + Intergenic
1100416583 12:94384115-94384137 TCTCTTTTGGATAGGTCTACTGG + Intronic
1100617399 12:96241709-96241731 TCCCTTTGGGACAGGATTCCGGG - Intronic
1101720193 12:107344273-107344295 TCCCTTGGGGATATGGGTGCTGG - Intronic
1104204357 12:126622976-126622998 TTCCCATGGGGTAGGTGTGCAGG - Intergenic
1104419272 12:128621722-128621744 TCCCAGTGGGACAGGTGTGTGGG - Intronic
1104862918 12:131934015-131934037 TCCCTTTGTGGTAGGTGAGGCGG + Intronic
1107929220 13:45293034-45293056 TGTCTTTGGGATAGGGGTGGAGG - Intergenic
1111745924 13:92269691-92269713 TCCCTTCGGGCCAGGTGTGGTGG - Intronic
1113725438 13:112596285-112596307 TTCTTTTGGGATAGGTATGATGG + Intergenic
1114181102 14:20368736-20368758 TCCCTTTGGGATAGGTGTGCAGG + Intronic
1115034915 14:28845651-28845673 TCCCTTTGGTAGACATGTGCAGG + Intergenic
1115598872 14:34936332-34936354 TTCCTTTGGGATAGGTGGTCGGG + Intergenic
1116641630 14:47470724-47470746 TCCCTGTGGGATAGGTTTAATGG + Intronic
1119424488 14:74526924-74526946 TCCCTCTGGGAGTGGTGTACAGG - Intronic
1122849677 14:104521003-104521025 TCCCTTTGGGAAAGGCGTGGAGG - Intronic
1125240312 15:37566562-37566584 TCCTTTTAGGGTAGGTCTGCTGG - Intergenic
1129123771 15:73420505-73420527 TCCCTTTGGGATAAGGGTTGAGG + Intergenic
1129884664 15:79029979-79030001 TCCCTTGGGGAAGAGTGTGCGGG + Intronic
1132235933 15:100221727-100221749 TGCCTCTGGGACAGGTTTGCCGG + Intronic
1132510564 16:339088-339110 TCCCTTTGGGCAGGGTGTGGTGG + Intronic
1132989082 16:2783861-2783883 TCCCAGTGGGAAAGGTGGGCTGG - Intergenic
1136244709 16:28967834-28967856 TCCCTTTGGGGTACCTGTGTGGG + Intergenic
1137486311 16:48894405-48894427 TCCCGTTGGGCTTTGTGTGCTGG - Intergenic
1139422405 16:66856781-66856803 TCCCTTGAGGCCAGGTGTGCTGG - Intronic
1139450436 16:67024806-67024828 TCCCTATGGGATGGCTGAGCTGG + Intergenic
1139872485 16:70118623-70118645 TACCTTTGGGAAAGGTATTCTGG + Intronic
1140245219 16:73242208-73242230 TACCTTTGTGATACTTGTGCTGG - Intergenic
1141585935 16:85033649-85033671 TCCCTTTGGGCTGGGGGTGGGGG + Intronic
1147349527 17:39829610-39829632 TCCCTTTTGGGTATGTGTGAAGG - Intronic
1147544562 17:41390780-41390802 TCCTCTTGTGATAGGTGGGCGGG - Intronic
1148545913 17:48518927-48518949 TCCCTGGAGGATAGGTGGGCTGG - Intergenic
1148984133 17:51606804-51606826 TCACTTTGCCATTGGTGTGCTGG + Intergenic
1149864037 17:60140431-60140453 TCACTTTGTGAAAGATGTGCGGG - Intergenic
1152387069 17:79980974-79980996 GCCCTTTGGGGTTGGGGTGCTGG - Intronic
1153987558 18:10367093-10367115 TCCCCTTGGGAGAGGGGTGGAGG - Intergenic
1153990366 18:10393452-10393474 TTCTTTTAGGATAGGTCTGCTGG - Intergenic
1154054567 18:11000616-11000638 TCCCTTTGGTTCAGGGGTGCAGG - Intronic
1154932298 18:21012303-21012325 TTCCTTTAGGGAAGGTGTGCTGG + Intronic
1157722061 18:49932759-49932781 TCCCCTTGGGATATGTGAACAGG - Intronic
1158143727 18:54286654-54286676 TGCCTTTTGGTTAGGTGTGTTGG + Intronic
1160146715 18:76371434-76371456 CCCCTTGGGGATAGCTGGGCGGG + Intronic
1165948857 19:39461406-39461428 TACCTTTTGGCTAGGTGTGGTGG + Intronic
1166908352 19:46132244-46132266 TCCCTGTGGCATAGCTGTGGGGG + Intergenic
1167674861 19:50877780-50877802 TCCCTTTGGGATCAGACTGCAGG + Intronic
925242270 2:2341733-2341755 TCACACTGGGATAGGTCTGCTGG + Intergenic
925485802 2:4329266-4329288 TCACTTTGGGAGAGGAGTACTGG + Intergenic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
926215996 2:10905691-10905713 TCCCTTGGGGAAAGGAGGGCTGG + Intergenic
928423311 2:31156882-31156904 TCCCTTGGGAATATGTGTGAAGG + Intergenic
929348270 2:40914723-40914745 TCAATTTGGGATAGGGGTGTGGG - Intergenic
934681053 2:96284218-96284240 TCCCTTTGGAATAGGGCAGCAGG + Intronic
936007119 2:108899403-108899425 TTCTTTTAGGATAGGTCTGCTGG - Intronic
941168424 2:162108562-162108584 GCCCTTTGGGAAAGGGGTGCTGG - Intergenic
941202720 2:162532634-162532656 CCCCTTTGGGAAACGTGTGTGGG - Intronic
947092609 2:226529393-226529415 TCTTTTAGGGATAGGTGGGCTGG - Intergenic
948534759 2:238637606-238637628 TTCCTTTGGGCTAGGAGTGCAGG - Intergenic
1168921181 20:1537522-1537544 TCACTTTGTGTCAGGTGTGCTGG + Intronic
1173798761 20:45881315-45881337 TCCCTTTGGGAGCTGTGTGACGG - Intronic
1173966057 20:47113735-47113757 TCCCTTAAGGAGGGGTGTGCTGG - Intronic
1176260935 20:64179405-64179427 TCCCTCTGGCATAGAGGTGCTGG - Intronic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178076163 21:29014932-29014954 TTCTTTTAGGATAGGTCTGCTGG + Intronic
1183057654 22:35316902-35316924 TCTCTTTGGGGTAGTTCTGCTGG + Intronic
1184088630 22:42281012-42281034 TCCGTTGGGGATAGGTCTGGGGG + Intronic
950431731 3:12954823-12954845 CCCCTTTGTGTTAGGAGTGCTGG - Intronic
950612175 3:14133662-14133684 TCCCTTTGGGTTGTTTGTGCTGG - Intronic
951602423 3:24391076-24391098 TGCCCTTGGGACAGGTGAGCAGG + Intronic
953031982 3:39185436-39185458 TGGCTCTGGGTTAGGTGTGCAGG + Exonic
953370890 3:42387627-42387649 TTCCTTTTAGACAGGTGTGCAGG + Intergenic
953703967 3:45217543-45217565 TCCCCTTGGGATAGCTCTGCAGG + Intergenic
954037361 3:47858562-47858584 TCCCCTTGGGAGAGGTGAGGGGG + Intronic
958133564 3:89459808-89459830 TCCCTTTGGGCTGGATGTGGTGG - Intronic
958260145 3:91370569-91370591 GCGTTTTTGGATAGGTGTGCTGG - Intergenic
959374129 3:105566924-105566946 TTCCTTTAGGAAAGGTCTGCTGG + Intronic
960659491 3:120042484-120042506 TCCCTTGGGGAAAGGAGTCCAGG + Intronic
960970975 3:123140020-123140042 CGCCTTTGGGATAGGTGGTCAGG + Intronic
961320572 3:126070711-126070733 TTCCTTTAGGGCAGGTGTGCTGG - Intronic
961465639 3:127079405-127079427 TCCCTTGGGGACATGTGGGCAGG - Intergenic
962140261 3:132782871-132782893 TCCATTTGGGCCAGGTGTGGTGG - Intergenic
962534346 3:136314387-136314409 ACCCTTTGGGCTGGGTGTGGTGG + Intronic
976104536 4:81602595-81602617 TGCCATTGGGATGGGTGTGGAGG + Intronic
981725481 4:147842897-147842919 TCCTTTTGAGATAGGTGAGGAGG - Intronic
982705716 4:158706760-158706782 TCCCTTAAGGTTAAGTGTGCCGG - Exonic
989533085 5:42530848-42530870 TCTCTTTGGAATAGGTTTGTGGG + Intronic
990722648 5:58714435-58714457 TCCCATTGGGGAAGGTCTGCCGG - Intronic
992936548 5:81713013-81713035 TCCCTTTAGGCCAGGTGTGGTGG - Intronic
994058511 5:95447218-95447240 TCCCATTGGGTAAGGTGTGCTGG - Intronic
996850104 5:127942079-127942101 TTCCTTTGGGAAAAGTGTCCTGG + Intergenic
998090153 5:139361312-139361334 TCCCTTTGGGATAAGTTTCAGGG - Intronic
1004010582 6:11682231-11682253 TCCCTTTAGAAAAGGTTTGCAGG + Intergenic
1004854337 6:19734136-19734158 CACCTTTGGGCCAGGTGTGCTGG - Intergenic
1005284189 6:24307097-24307119 TCCCTTTGGGCTAGTTTAGCAGG - Intronic
1005985445 6:30871007-30871029 TCCTTTTAGGCTAGGTGTGGTGG + Intergenic
1007507493 6:42347238-42347260 TGCCTTTGGGAGAGGTGGGTGGG - Intronic
1008907920 6:56699993-56700015 TCCCTATGGTATAGGTTTGGGGG - Intronic
1008995089 6:57649835-57649857 TGCGTTTTGGATAGGTGTGCTGG + Intergenic
1009183624 6:60548595-60548617 TGCGTTTTGGATAGGTGTGCTGG + Intergenic
1010142661 6:72628898-72628920 TCACTTTGGGCCAGGTGTGGTGG - Intronic
1012591815 6:100991146-100991168 TCTCTTTAGTATAGGTCTGCTGG + Intergenic
1016247302 6:141998014-141998036 TCCCATTGGGCTTGGTATGCTGG - Intergenic
1016657475 6:146538504-146538526 TTCCTTTGGGGTAGGCCTGCTGG + Intergenic
1017562272 6:155641170-155641192 CCCCTTAGAGATATGTGTGCTGG + Intergenic
1018230769 6:161673250-161673272 TCCCATGGGGATAAGTGTGCGGG + Intronic
1020212362 7:6166309-6166331 TCCCTTAGGGAGAGGAGGGCAGG - Intronic
1022409893 7:30131426-30131448 TGCCTTTGGGAGATGTGTGTTGG - Intergenic
1022632002 7:32094074-32094096 CCCCCATGGCATAGGTGTGCTGG + Intronic
1022706461 7:32806373-32806395 TCCCTTTTGGCCAGGTGTGGTGG + Intergenic
1026890955 7:73982156-73982178 TCCTTTGGGGATAGGCGTGAAGG + Intergenic
1026982592 7:74535596-74535618 TCCTCCTGGGACAGGTGTGCTGG - Intronic
1027168649 7:75854123-75854145 TGGCTTTGGGATAGGTATGGTGG + Intronic
1032580356 7:133098173-133098195 TCCCTTTGGGTCAGCTTTGCAGG - Intergenic
1033445955 7:141422298-141422320 TTCCTTTGGGAAAGCTTTGCAGG + Intronic
1033649131 7:143327476-143327498 TCCCTTTGTCAGATGTGTGCAGG + Intronic
1037777487 8:21845160-21845182 CCCCTTTGGGAAAGGAGAGCAGG + Intergenic
1038361978 8:26888990-26889012 TTCCTTTAGTATAGGTTTGCTGG + Intergenic
1042467404 8:69143407-69143429 TCACTTTTGGTTAGATGTGCAGG + Intergenic
1050132076 9:2423104-2423126 TTCCTTTGAAATAGGTGTTCTGG + Intergenic
1052031716 9:23636635-23636657 TCCCATTAGGCCAGGTGTGCTGG + Intergenic
1053050015 9:34953655-34953677 TCCCTTTAGGCTAGGTGTGGCGG + Intergenic
1056939273 9:90941369-90941391 TCAATTTGGGATAGGTTTGAAGG - Intergenic
1057784875 9:98079637-98079659 TCTCTGTGGGATGGGAGTGCAGG - Intronic
1059060821 9:111034015-111034037 TCCATTTGGGAGAGGTATTCAGG - Intronic
1059142183 9:111864114-111864136 TTCCTTTGGGAGAGGAGTGGAGG - Intergenic
1060210362 9:121706622-121706644 GCCCTTTGAGGTAGGTGGGCAGG - Intronic
1061114803 9:128602921-128602943 TCCCTTAGGGCTAGGCATGCTGG - Intronic
1061929622 9:133825648-133825670 TTCCTCTGGGAGAGGTGGGCAGG + Intronic
1061950436 9:133932962-133932984 TCCCTTTGGGACAGGTGTAGAGG - Intronic
1062343028 9:136102177-136102199 TCCCTCTGGGCTACGTGGGCGGG + Intergenic
1062536896 9:137025058-137025080 TGCCTTTGGGCCAGGTGTGGTGG - Intronic
1186853601 X:13604381-13604403 TCCCTCTGGGGCAGGAGTGCTGG + Intronic
1188508886 X:30912363-30912385 TCCCTTTGGGAAAGGACTGGTGG - Intronic
1189420100 X:40849396-40849418 TTTCTTTGGGATAAGTGTTCCGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1192253086 X:69429782-69429804 TCCCTTGAGGCTAGGTGTGGGGG + Intergenic
1192510834 X:71719550-71719572 TCCCAGTGGGAGAGGCGTGCTGG + Intergenic
1192515863 X:71762003-71762025 TCCCAGTGGGAGAGGCGTGCTGG - Intergenic
1192522374 X:71814278-71814300 TCCCAGTGGGAGAGGTGTGCTGG + Intergenic
1194740448 X:97566590-97566612 TCCCTATGTGAAACGTGTGCAGG - Intronic
1199001803 X:142647743-142647765 TGCCTTTGGTGTAGGTGTTCTGG + Intergenic