ID: 1114182776

View in Genome Browser
Species Human (GRCh38)
Location 14:20379835-20379857
Sequence AGAGTGATAACAGGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114182774_1114182776 19 Left 1114182774 14:20379793-20379815 CCTTTGAGCTGATGTGCAGGCAG 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG 0: 1
1: 0
2: 3
3: 25
4: 211
1114182771_1114182776 25 Left 1114182771 14:20379787-20379809 CCAAGCCCTTTGAGCTGATGTGC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG 0: 1
1: 0
2: 3
3: 25
4: 211
1114182773_1114182776 20 Left 1114182773 14:20379792-20379814 CCCTTTGAGCTGATGTGCAGGCA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG 0: 1
1: 0
2: 3
3: 25
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114182776 Original CRISPR AGAGTGATAACAGGTGTGTT TGG Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
903773860 1:25780822-25780844 AGGGTGATGTCAGGTGTGTGTGG - Intronic
905118720 1:35665123-35665145 ATAATGAAAACAGGTGTGTTAGG - Intergenic
905740216 1:40363766-40363788 AGAGAGAGAACTGGTGTGCTTGG + Intronic
906840335 1:49131480-49131502 AGTGTGATAACTGCTATGTTGGG + Intronic
907847834 1:58225720-58225742 TGAGTGAGAACATGGGTGTTTGG - Intronic
909538715 1:76767442-76767464 AGATTGATAACAGAAGGGTTTGG + Intergenic
912385901 1:109271041-109271063 TGAGTGCTAGCAGGTGGGTTGGG + Intronic
913158120 1:116120139-116120161 AAAGTGATAGGAGGTGAGTTTGG - Intronic
914732827 1:150387353-150387375 AGTGCAAAAACAGGTGTGTTAGG + Intronic
915757963 1:158281218-158281240 TGAGTGAGAACATGTATGTTTGG + Intergenic
916152534 1:161809276-161809298 TGAGTGAGAACATGTGTGTTCGG + Intronic
916178496 1:162063223-162063245 ACAGTGCAACCAGGTGTGTTTGG - Intergenic
917349639 1:174063625-174063647 GGAGTGATAACATGGGTGTGAGG - Intergenic
917576949 1:176333085-176333107 TGAGTGAGAACATGCGTGTTTGG + Intergenic
919219381 1:194606771-194606793 TGAGTGAGAACATGAGTGTTTGG + Intergenic
920569634 1:207006977-207006999 ATAGTGCTCACAGGTGTCTTTGG + Intronic
923186285 1:231576723-231576745 AGAATGATAACAACAGTGTTGGG - Intronic
1068789501 10:61011693-61011715 AGAGTAAAAACAGTTGTGGTAGG - Intergenic
1069139235 10:64803061-64803083 TGGGTGATAACAGGGGTGGTTGG + Intergenic
1069607851 10:69751262-69751284 AAAGCGATTACAAGTGTGTTTGG + Intergenic
1070464127 10:76702852-76702874 AGAGTGAGAACCTGTGTGTTTGG + Intergenic
1070857281 10:79615917-79615939 AGAGTGTTCACAGGTGTTATAGG - Intergenic
1074570513 10:114619995-114620017 ATTGTGATAATAGGTATGTTTGG - Intronic
1076978470 11:192859-192881 AGAGAGAGAACAGGTGTGTTAGG - Intronic
1077779724 11:5313892-5313914 TGTGTGAGAACATGTGTGTTTGG - Intronic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1078048535 11:7940658-7940680 AGAGTGATAACAATTGCTTTAGG + Intergenic
1078600107 11:12722742-12722764 AAAATGAAAACAGTTGTGTTAGG - Intronic
1080310143 11:30880548-30880570 AGAGTGATAACAGTGTTCTTCGG + Intronic
1083047051 11:59746609-59746631 AGAGTGATAACTGCTGTAATTGG + Intronic
1083145293 11:60753621-60753643 AGGGAGATAACAGTTGTGTCTGG + Intergenic
1087579594 11:100035202-100035224 TGAGTGAGAACATGTGTGTTTGG + Intronic
1087899132 11:103621020-103621042 AAAGTGATGGCAGTTGTGTTTGG - Intergenic
1090524120 11:127511339-127511361 TGAGTGAGAACATGTGTGTTTGG + Intergenic
1091929366 12:4382582-4382604 AGAGGGAGCACAGGTGTCTTGGG + Intergenic
1092315208 12:7405048-7405070 ACAGTGAAAACAGATGTGTATGG - Intronic
1092402805 12:8191384-8191406 TAAGTGAGAACATGTGTGTTTGG + Intergenic
1093860993 12:24167375-24167397 AAATTGTTAATAGGTGTGTTTGG - Intergenic
1094793681 12:33945277-33945299 AGAGTGATAACAGATGGATCAGG + Intergenic
1095104951 12:38222086-38222108 AGAGTGATAACAGATGGATCCGG + Intergenic
1095492306 12:42747544-42747566 AGAGTGCTTACAGGAGTGATTGG + Intergenic
1096821165 12:54235980-54236002 AGAGAGAAAACAGGTGAGTTGGG - Exonic
1097305454 12:58063769-58063791 TGAGTGAGAACACGCGTGTTTGG - Intergenic
1098334390 12:69387686-69387708 AGAATGATACCACTTGTGTTGGG + Intronic
1102848749 12:116217634-116217656 AGTGTGATAAAAGCTGTGATGGG - Intronic
1102883975 12:116508090-116508112 AGAGCGATAACAGCAATGTTGGG - Intergenic
1105223584 13:18357359-18357381 ACAGTGATACCACTTGTGTTAGG + Intergenic
1105646515 13:22324153-22324175 ACAGGGATCACTGGTGTGTTTGG - Intergenic
1106521104 13:30498447-30498469 AGAGGGATAAGAGCTGTGGTGGG + Intronic
1106755483 13:32819057-32819079 TGAGTGATTACAGGTGGGGTAGG + Intergenic
1107129548 13:36880291-36880313 AAAATGATAAGAGCTGTGTTTGG - Intronic
1107761711 13:43686630-43686652 AGTGTGATACCATGTGTGTAAGG - Intronic
1108289560 13:48945278-48945300 AGAGTAATGACATGTGTGTTTGG + Intergenic
1108854076 13:54771954-54771976 TGAGTGAGAACATGAGTGTTTGG + Intergenic
1112195924 13:97226194-97226216 AGAGTAAAAACAGGTGTGAAAGG + Intronic
1112710978 13:102128594-102128616 AGAGTGATAACATGTGTTCATGG - Intronic
1113105750 13:106770269-106770291 AGAGAGATATCAGATGTGCTTGG - Intergenic
1114182776 14:20379835-20379857 AGAGTGATAACAGGTGTGTTTGG + Intronic
1114210700 14:20611806-20611828 AGGGTGATAATGAGTGTGTTGGG + Intergenic
1114712655 14:24794316-24794338 AAAATGATAACAGGAGTGTATGG + Intergenic
1115435396 14:33366481-33366503 AGTGAGAAAACAGGAGTGTTCGG + Intronic
1115457700 14:33623704-33623726 AGAGAAATAAAAGGTGTGTGGGG - Intronic
1115715020 14:36094015-36094037 AGGGAGAGAGCAGGTGTGTTGGG + Intergenic
1116641790 14:47472874-47472896 AGGGTGATTACAGGAGTGTCTGG + Intronic
1117710411 14:58522809-58522831 AGCGTGGCAACAAGTGTGTTAGG + Intronic
1118860315 14:69657937-69657959 AATGTGGTCACAGGTGTGTTGGG + Intronic
1118979328 14:70703346-70703368 AAAGTAATAACAGGTCTATTTGG + Intergenic
1119359131 14:74033128-74033150 TCAGAGATAAAAGGTGTGTTAGG + Intronic
1122019245 14:98822547-98822569 TGAATGAAACCAGGTGTGTTAGG - Intergenic
1122306956 14:100772567-100772589 GGAGGGAGAGCAGGTGTGTTGGG + Intergenic
1127303900 15:57683399-57683421 AGAGACATAACAGCTGTGCTGGG - Intronic
1127853601 15:62936437-62936459 AAAATGATAATAGTTGTGTTAGG - Intergenic
1128515055 15:68336917-68336939 AGAGTGAAAACTGTTGTGTCTGG - Intronic
1130026561 15:80275911-80275933 ACAGTGATAACAGTTGAGTGTGG + Intergenic
1131443916 15:92479838-92479860 TGAGTGAGAACATGTGTGCTTGG + Intronic
1131772607 15:95755598-95755620 GGGGTGCTAAAAGGTGTGTTTGG + Intergenic
1131849907 15:96527794-96527816 ATACTGATAACATGTGTGGTTGG + Intergenic
1132254503 15:100364221-100364243 TGAGTGAGAACATGTGTGTTTGG - Intergenic
1134558465 16:15186869-15186891 TGAGTGATATCAGGGGTATTGGG - Intergenic
1134918996 16:18098471-18098493 TGAGTGATATCAGGGGTATTGGG - Intergenic
1137027776 16:35495677-35495699 ACAGTGTTTGCAGGTGTGTTTGG - Intergenic
1140245127 16:73241486-73241508 AGAGTAATAAAAGGAGGGTTGGG + Intergenic
1142465900 17:137350-137372 AGAGAGAGAACAGGTGTGTTAGG - Intergenic
1146638658 17:34524280-34524302 TGAGTGATAACTACTGTGTTTGG - Intergenic
1147694550 17:42341413-42341435 TGAGTGAGTTCAGGTGTGTTTGG - Intronic
1148839317 17:50484533-50484555 AGCTGGATCACAGGTGTGTTGGG + Exonic
1149137367 17:53384248-53384270 AATGTTATAACAGGTGTGATGGG + Intergenic
1149557925 17:57587520-57587542 GGAGTGATCTCAGGTGTGTGAGG - Intronic
1155795676 18:30033847-30033869 TGAGTGAGAACATGCGTGTTTGG + Intergenic
1156128686 18:33940458-33940480 TGAGTGAGAACATGCGTGTTTGG - Intronic
1156543930 18:37945021-37945043 AGAGTGATAACAGGAGGTTCTGG + Intergenic
1156724753 18:40114314-40114336 TGAGTGAGAACATGCGTGTTTGG + Intergenic
1156756901 18:40538680-40538702 AAATTGATAACAGGTGTCATTGG + Intergenic
1158045239 18:53147657-53147679 AGGATAATAACAGGTGTGTGAGG - Intronic
1158455497 18:57603724-57603746 AGCTTGAAAACAGGTGTGCTAGG - Intronic
1160269478 18:77371555-77371577 TGAATGAGAACATGTGTGTTTGG + Intergenic
1162954939 19:14092304-14092326 AGGGTGAAGACAGGTCTGTTGGG + Exonic
1166013457 19:39961196-39961218 AGGGTGAGAACAGGAGTTTTGGG - Intergenic
1166263698 19:41662928-41662950 TGAGTGAAAACAAGCGTGTTTGG - Intronic
1167194741 19:48020459-48020481 TGGGTGAGAACATGTGTGTTGGG + Intronic
1168212775 19:54902776-54902798 AGAGTTATGACAGCTGTGTAAGG + Intergenic
925053875 2:840479-840501 TGAGTGAGAACATGAGTGTTTGG - Intergenic
925067697 2:941291-941313 GGTGTGCTGACAGGTGTGTTAGG - Intergenic
930148463 2:48032256-48032278 TGAGTGAGAACATGAGTGTTTGG + Intergenic
930852202 2:55973103-55973125 GGGGTGATGACAGGGGTGTTTGG + Intergenic
931861599 2:66360414-66360436 TGAGTGAGAACATGTATGTTTGG + Intergenic
932356441 2:71071851-71071873 AGAGTGAGAACTGGTTTTTTTGG + Intronic
936615592 2:114044661-114044683 AGAATGATAATAGTTGTATTAGG + Intergenic
937062404 2:118990390-118990412 TGAATGAGAACAGGTGTGTTGGG - Intronic
938558149 2:132445121-132445143 ACAATAAAAACAGGTGTGTTAGG - Intronic
939222922 2:139326068-139326090 AGAGTGAGTATAGGTGTGTAGGG - Intergenic
939814075 2:146872271-146872293 AGAGGGATAACTGCTGAGTTAGG - Intergenic
941691500 2:168504610-168504632 CAAGTGTCAACAGGTGTGTTAGG + Intronic
941844970 2:170123335-170123357 AGTGTGAACACAGGTGTGTTTGG + Intergenic
942629239 2:177938143-177938165 AGAGTGCTAGCAGCTGGGTTTGG + Intronic
947785570 2:232815506-232815528 AGAGGCAAAACAGATGTGTTTGG + Intronic
948857140 2:240735461-240735483 AGAGAGATAGCAGGTGGGGTTGG + Intronic
1169863862 20:10179219-10179241 AAAATGATAAAAGCTGTGTTTGG - Intergenic
1173931959 20:46828059-46828081 TGGGTCATTACAGGTGTGTTGGG - Intergenic
1174280822 20:49437857-49437879 AGAATGATAACATGTTTGATGGG - Intronic
1174647510 20:52098503-52098525 AGAGTGATGACAGGGGCCTTCGG + Intronic
1176128791 20:63487592-63487614 AGAGTGAGACCAGGTGTGCGGGG + Intergenic
1176732126 21:10509739-10509761 ACAGTGATACCACTTGTGTTAGG + Intergenic
1177381434 21:20349493-20349515 AGCGTGAGAACAGGTGTGTAAGG + Intergenic
1177810947 21:25924521-25924543 TGAGTGAGAACATGAGTGTTTGG - Intronic
1178423254 21:32458813-32458835 AAAGTGAAAACAGTTGTGTTGGG - Intronic
1179558775 21:42199009-42199031 AGAGTCAAAACAGGTGGGTGTGG - Intergenic
1181440634 22:22933663-22933685 AGAGAGAGGACGGGTGTGTTAGG + Intergenic
1182944038 22:34305488-34305510 AAAGTGAAAACAGGTTTATTAGG - Intergenic
949367457 3:3298474-3298496 AGAGTGCTGAGAGCTGTGTTTGG + Intergenic
949748157 3:7319367-7319389 AGTGTGTTAACATGTTTGTTAGG + Intronic
950146631 3:10654674-10654696 AAAGTGGTAACAGGAGTGCTTGG + Intronic
951496443 3:23332903-23332925 AAAGTGATGACAGGTGTGCATGG + Intronic
951673182 3:25207784-25207806 AGAGGGATAGAATGTGTGTTAGG + Intronic
952359906 3:32619918-32619940 TGAGTGAGAACATATGTGTTTGG + Intergenic
952374670 3:32756135-32756157 AGAGTGATGAGAGGTGAGTTGGG + Intronic
952781431 3:37103554-37103576 TGAGGGAGAACTGGTGTGTTTGG - Intronic
953170024 3:40498439-40498461 TGAGTGAGAACAGGCGTGTTTGG + Intergenic
953453670 3:43024846-43024868 AGAGTGAAAAGGGGTGTGCTTGG + Intronic
954943009 3:54392549-54392571 AGAGGGATAACAGGTATGGAAGG + Intronic
955247699 3:57243404-57243426 AGAGTATTAACAGGTTTTTTTGG + Intronic
956457293 3:69434992-69435014 AAAGTGGTACCAGGGGTGTTTGG - Intronic
956535424 3:70270793-70270815 TGAGTGATAACTTGTGTTTTTGG - Intergenic
956703796 3:71982097-71982119 TGAGTGATAACAGGGGTGGCTGG + Intergenic
957596686 3:82275339-82275361 AGAGTGATAACACGTGGAATTGG - Intergenic
957631999 3:82727898-82727920 AGAGAGATACCAGGGATGTTGGG - Intergenic
957715807 3:83928489-83928511 AGAGAGATCTAAGGTGTGTTAGG - Intergenic
957892144 3:86373964-86373986 AGATTAATAACAGTTATGTTAGG + Intergenic
958835251 3:99137931-99137953 TGAGTGAGAACATGCGTGTTTGG + Intergenic
959194670 3:103165032-103165054 AGATTGGTAACAGGTGTGTTTGG - Intergenic
960636709 3:119791781-119791803 AGAGTGGAAACAGGTGTGAGAGG + Intronic
961496991 3:127300800-127300822 AGACTGAGATGAGGTGTGTTGGG + Intergenic
961591881 3:127987381-127987403 AAAGTGAAAACAGGAGTGATAGG - Exonic
964052469 3:152412661-152412683 AGAGAGAAATCACGTGTGTTTGG - Intronic
964440217 3:156700816-156700838 AAAGTAATAAAAGGTGAGTTTGG + Intronic
965617870 3:170613218-170613240 AGAGTGGTAACAGAATTGTTAGG - Intronic
966598079 3:181745650-181745672 AGATTGATAACAGCTTTGTGGGG - Intergenic
966692968 3:182760463-182760485 AGGGGGAAAAAAGGTGTGTTTGG - Intergenic
967498345 3:190167566-190167588 AGAGTGAAAACAGGAATGTTGGG + Intergenic
969165929 4:5312519-5312541 TGAGTGAGAACATGCGTGTTTGG + Intronic
972812677 4:42607979-42608001 AAAACTATAACAGGTGTGTTTGG - Intronic
973092684 4:46157887-46157909 TGGGTGATGACAGGGGTGTTGGG - Intergenic
973259238 4:48144498-48144520 AGAGTGAGAACAGGTGAGAAGGG + Intronic
973572015 4:52250351-52250373 AGAGTGAGAACATGTGTCTGCGG + Intergenic
973742821 4:53934916-53934938 TGAGTGAGAACATGTGGGTTTGG - Intronic
978173235 4:105699307-105699329 GGATTTAAAACAGGTGTGTTTGG + Intronic
978223518 4:106306022-106306044 AAAGTGAAAACAAGTTTGTTAGG - Intronic
978248441 4:106603539-106603561 AGAGTGACAAGGGGTGTGTGAGG + Intergenic
980851408 4:138387646-138387668 ACAGTGATAACAGGAGTGGAGGG - Intergenic
980861315 4:138502419-138502441 TGAGTGAGAACATGTGGGTTTGG + Intergenic
981531447 4:145758142-145758164 TGAGTGAGAAAAGGTGTGTTTGG - Intronic
982727679 4:158922319-158922341 AGAGTGAGAAGGGGTCTGTTGGG - Intronic
986165607 5:5269361-5269383 AGAGTGATAACATGGGATTTTGG - Intronic
988667742 5:33348398-33348420 TGAGTGAGAACATGCGTGTTTGG + Intergenic
988780434 5:34516341-34516363 AGAGTGACAGCATGTGTGTGGGG + Intergenic
988785628 5:34563566-34563588 AGGGTGTGAACACGTGTGTTGGG - Intergenic
990531764 5:56681261-56681283 AGAGTGATAGCAAGTTTATTTGG - Intergenic
990962937 5:61414023-61414045 AGAGTGATACCAGATGGGGTAGG + Intronic
993321313 5:86471039-86471061 ACAGTGATTACAGGTATATTAGG + Intergenic
993543495 5:89182193-89182215 AGAGTGATACCAGGTGTTTCTGG + Intergenic
993920214 5:93792610-93792632 TGAGTGAGAACATGCGTGTTTGG - Intronic
996983475 5:129530086-129530108 AGAGTGCTTACAGCTGTTTTAGG - Intronic
997047410 5:130334874-130334896 AGAGTAATTAGAGGTGTCTTAGG + Intergenic
997238409 5:132289085-132289107 ACAGGGATAACAGGGGTGTGAGG + Intronic
997499945 5:134365536-134365558 AGAGTAAAAATAGGTCTGTTAGG - Intronic
1000174388 5:158736715-158736737 AGAGTTATTACATATGTGTTAGG + Intronic
1001197765 5:169689082-169689104 CGAGAGATCACAGTTGTGTTGGG - Intronic
1002527373 5:179822088-179822110 AGGGTGATAAAAGGTATGTATGG - Intronic
1003508956 6:6763421-6763443 AGTGTGGTAGAAGGTGTGTTTGG + Intergenic
1003936753 6:10982775-10982797 AGAGTGACAACAGGTATCTGAGG + Exonic
1005978840 6:30820475-30820497 AGAGTTATGAGAGGTGTGGTTGG + Intergenic
1006635703 6:35459813-35459835 AGAGTGACATCACATGTGTTGGG + Intronic
1008868081 6:56239455-56239477 AAAATGTTAACAGTTGTGTTTGG - Intronic
1009707431 6:67270725-67270747 AGAGTTTTGACAGGTGTGATTGG - Intergenic
1009844295 6:69116355-69116377 GGGGTGAAAACAGGTGTGTGTGG - Intronic
1011182508 6:84636611-84636633 TGAGTGAGAACATGCGTGTTTGG + Intergenic
1011252767 6:85390323-85390345 ATAGTAATAGCAGGTGTGATGGG - Intergenic
1011308252 6:85953135-85953157 TGAGTGAGAACAAGGGTGTTTGG + Intergenic
1012818705 6:104057714-104057736 TGAGTGAGAACACGCGTGTTTGG - Intergenic
1014256022 6:119160514-119160536 AAGGTGATAACAGGTGTGAAGGG - Intergenic
1016430052 6:143973939-143973961 AGAGATATAACAGGTTTTTTTGG + Intronic
1017008076 6:150042506-150042528 AGAGTGGAAACAGGTGTGAGAGG + Intergenic
1018953040 6:168391444-168391466 AGAGACAGGACAGGTGTGTTGGG - Intergenic
1021679231 7:23113063-23113085 GGATTGATAGTAGGTGTGTTTGG + Intronic
1022454124 7:30543381-30543403 TGAGTGAGAACATGCGTGTTTGG - Intronic
1022786643 7:33644619-33644641 AGGATGATTACAAGTGTGTTTGG + Intergenic
1023046791 7:36217099-36217121 AAAGTGAAAACAAGTTTGTTAGG + Intronic
1023788337 7:43730445-43730467 AGAGTGATAGAATGTATGTTTGG - Intergenic
1025781089 7:64602402-64602424 AGAGTGATACCATTTATGTTAGG + Intergenic
1027468633 7:78545992-78546014 AGGGTGATAAAATATGTGTTGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028616662 7:92776142-92776164 TGAGTGAGAACATGAGTGTTTGG + Intronic
1030894308 7:115038369-115038391 AGAGCGCTAAGAGGTGTGTCAGG + Intergenic
1034189908 7:149206052-149206074 AGACTGATGACAAGTGTGTTCGG - Intronic
1038068411 8:23986932-23986954 TGGGTGATGACAGGTGTGTGAGG + Intergenic
1039416400 8:37398152-37398174 AGAGTGAAAATAATTGTGTTAGG - Intergenic
1042282216 8:67066434-67066456 AGTGTGATAACATGTGCGGTGGG - Intronic
1042739018 8:72022323-72022345 AAAGTGACATCAGGTGTGTTGGG + Exonic
1045092618 8:98762140-98762162 AGTGTGGTAACAGCTGTGATGGG - Intronic
1045110257 8:98933751-98933773 AGAGTGATTCCAGGTGAGATTGG + Intronic
1046943365 8:119952657-119952679 TGAGTGAGAACATGTGGGTTTGG + Intronic
1048397462 8:134027857-134027879 AGAGAGAGAACAGGTGTGTATGG - Intergenic
1048630395 8:136236041-136236063 AGAGTGGTAAGAGCTGTGTTTGG + Intergenic
1050246376 9:3694367-3694389 ACACTGAACACAGGTGTGTTCGG - Intergenic
1051076625 9:13245950-13245972 AGAGTGCTAGCAAGTCTGTTGGG - Intronic
1052049176 9:23825465-23825487 AGAGTGATAACTTGGGTGTTGGG - Intronic
1052743878 9:32420715-32420737 AAAGTGATCACAAATGTGTTGGG + Intronic
1061393184 9:130328941-130328963 ATTGAGATAACAGGTGTGGTAGG - Intronic
1061807688 9:133145553-133145575 AGAGTGATGGCAGATGTGTGAGG + Intronic
1186653860 X:11591868-11591890 AGACTGACAACAGGTTTCTTGGG + Intronic
1187264007 X:17714347-17714369 AGTGTGGTAGGAGGTGTGTTAGG - Intronic
1187962718 X:24581973-24581995 AAAGTGATAAAAGAAGTGTTTGG - Intronic
1194475684 X:94357483-94357505 TGAGTGAGAACATGCGTGTTTGG - Intergenic
1195875051 X:109531765-109531787 ATAGTGGTCACAGGGGTGTTGGG - Intergenic
1196264471 X:113626173-113626195 AGAGTGACACCAGCTGTGTCAGG - Intergenic
1196463874 X:115953409-115953431 GGTGTGAGAACAGGTGTGTTCGG - Intergenic
1198127657 X:133662167-133662189 AGAGTGATTAGAGCTGTGCTAGG + Intronic
1199688802 X:150290564-150290586 ACAGTGATAACAGATGTTATTGG + Intergenic
1201537189 Y:15063339-15063361 AGAGTGAGAACAAGAGTGTTTGG + Intergenic