ID: 1114183502

View in Genome Browser
Species Human (GRCh38)
Location 14:20383645-20383667
Sequence CTGTACATGGAGAGGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114183497_1114183502 -9 Left 1114183497 14:20383631-20383653 CCCACACCAGGCTTCTGTACATG 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 201
1114183498_1114183502 -10 Left 1114183498 14:20383632-20383654 CCACACCAGGCTTCTGTACATGG 0: 1
1: 0
2: 2
3: 9
4: 169
Right 1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 201
1114183495_1114183502 5 Left 1114183495 14:20383617-20383639 CCTCTGCTGCAGCTCCCACACCA 0: 1
1: 1
2: 9
3: 73
4: 525
Right 1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114183502 Original CRISPR CTGTACATGGAGAGGAAGTC AGG Intronic
900243794 1:1628714-1628736 CTGTCCAGGGTGAGGAAGTGTGG + Exonic
901048426 1:6413241-6413263 CTGAGCATGGAGGGGAAGCCAGG + Intronic
902404912 1:16177306-16177328 CCTTCCATGGAGAGGAATTCTGG + Intergenic
902976757 1:20094125-20094147 CTCTACAGGGAAAGGAATTCTGG - Intergenic
905922458 1:41728581-41728603 CTGTAGATTGAGAACAAGTCTGG - Intronic
906225719 1:44119558-44119580 CGTTACATGAAGAAGAAGTCAGG + Intronic
909322862 1:74312150-74312172 ATGGACATGGAAAGAAAGTCGGG + Intronic
915092100 1:153433692-153433714 CTGCACAGGGAGAGGATGACCGG + Intergenic
915142131 1:153774458-153774480 CTGTACCTGGAGATAAAGTCTGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917249740 1:173045220-173045242 GTGTAGATGGAGAGGAACACTGG + Intronic
917393543 1:174566225-174566247 CAGTAACTGGAGAGGAAGTGAGG + Intronic
917989703 1:180361320-180361342 CTTTATATTGAGAGGATGTCAGG + Intronic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918310666 1:183283142-183283164 CTGTCCAAGGACTGGAAGTCAGG - Intronic
919904132 1:202066260-202066282 CGTTACATGGAGAGTAACTCTGG + Intergenic
921710668 1:218370080-218370102 CTGCACTTAGTGAGGAAGTCAGG + Intronic
923996050 1:239495601-239495623 CTGTTCAAAGAGAGGAAGGCTGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065235199 10:23643546-23643568 GTTTACATGGAGGGGAAGTCTGG + Intergenic
1068377125 10:56195367-56195389 CTGGTCAGGGAGAGGAAGGCTGG + Intergenic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1069874751 10:71554981-71555003 GTGTGCATGGAGAGGAATACAGG + Intronic
1071169037 10:82841910-82841932 GTGTGGATGGAGAGGAATTCTGG + Intronic
1073336440 10:102714066-102714088 CTGGGCCTGGAGAGGAAGGCGGG - Intronic
1074281554 10:112056439-112056461 TTGAACATGCAGATGAAGTCAGG + Intergenic
1074363934 10:112843202-112843224 CTGTACAGGGAAAGGGATTCTGG + Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1077461135 11:2711230-2711252 CAGTACATGGGGAGGAAGTATGG - Intronic
1078593582 11:12667115-12667137 GTGGTCATAGAGAGGAAGTCCGG + Intergenic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1082849444 11:57752712-57752734 CTGAACATTGAGAGGAAGCAAGG - Intronic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1084188125 11:67486122-67486144 CTGGTCATTGAGAGGATGTCAGG - Intronic
1084583843 11:70042342-70042364 CAGCACAGGGAGAGGAACTCAGG + Intergenic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1086252392 11:84832091-84832113 CCATACATGAAGAGGAATTCTGG + Intronic
1087655014 11:100911999-100912021 CTGAAAAGGGAGAGTAAGTCAGG - Intronic
1089096247 11:115922415-115922437 ATAAAAATGGAGAGGAAGTCAGG - Intergenic
1091798067 12:3308622-3308644 GTGTGCATGGCCAGGAAGTCAGG - Intergenic
1097169429 12:57104652-57104674 CTCTCCTTGGAGAGGATGTCAGG - Intronic
1101276008 12:103202230-103202252 CTGTAAATGGAATGGAACTCTGG - Intergenic
1102235403 12:111291395-111291417 CTGTGCAGGGAGAGAAAGACAGG - Intronic
1104960915 12:132488436-132488458 CTGTCCAGGGAGGGGAATTCGGG + Intergenic
1105622877 13:22086263-22086285 CTGCACATGGAGAAGAATTGTGG + Intergenic
1107686237 13:42902187-42902209 CTGTACTATGAGAGGAAGTTGGG - Intronic
1108026686 13:46185337-46185359 GAGTGCATGGAGAGGAAGTGGGG - Intronic
1110169870 13:72487780-72487802 CTGAAAATGGAGAGCAAGTATGG - Intergenic
1112976326 13:105323038-105323060 CTTTACATGGTGAAGAAGTAAGG + Intergenic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1113432476 13:110262613-110262635 CTGTACAAGAAGAGGAAGCATGG + Intronic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114496964 14:23139548-23139570 CTGTAGAGGGAGAGGAGGTGAGG + Intronic
1117089810 14:52238263-52238285 CTGTAAATGGAGAGAAGTTCGGG + Intergenic
1117218426 14:53576285-53576307 CTGCACATGGTGAGGAAGAGAGG - Intergenic
1120199031 14:81516870-81516892 AGGTACATGGGGGGGAAGTCTGG - Intronic
1120876605 14:89381452-89381474 CTTTACATGGCCAGGATGTCGGG - Intronic
1121217555 14:92260283-92260305 CTGTCCCTGTAGAGGAAGTGTGG - Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122251036 14:100439973-100439995 CTGAACATGCACTGGAAGTCAGG - Intronic
1123165557 14:106322425-106322447 ATGTACATGAAGAGGAGGGCTGG - Intergenic
1125108753 15:36005730-36005752 GAGTTCCTGGAGAGGAAGTCTGG + Intergenic
1125189830 15:36977889-36977911 CAGTAAATGGAGTGGAATTCAGG - Intronic
1126412334 15:48385211-48385233 GTGTCCATGCAGAGGATGTCAGG - Intergenic
1127877443 15:63122673-63122695 CTGTAGATGGAAAAGAAGTCTGG + Exonic
1128215443 15:65931115-65931137 CTGGAGATGGAGAGAATGTCAGG + Intronic
1129109263 15:73328209-73328231 CTGGACGTGGAGAGGGTGTCAGG + Intronic
1132463189 16:65658-65680 TTGTCCCTGGAGTGGAAGTCTGG - Intronic
1132916056 16:2345014-2345036 ATGACCATGGAGAGGAAATCAGG - Intergenic
1133201824 16:4208445-4208467 CTGTATATGGAGGGAAAGTTGGG + Intronic
1133393221 16:5425979-5426001 GTGTGCAGGGACAGGAAGTCTGG + Intergenic
1133393593 16:5428719-5428741 CATTACATGGAGAGGAGGCCAGG + Intergenic
1133807764 16:9138495-9138517 CTGCCCATGGAGAGGAAGCGGGG - Intergenic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1134870230 16:17646234-17646256 CTCTACATGGTGAGGAACTGAGG + Intergenic
1135422844 16:22316505-22316527 CTGGCCATGGAGTGGAAGACGGG + Intronic
1137715545 16:50596087-50596109 CTGTACATGCATAGGAAGCCAGG - Intronic
1138279885 16:55764674-55764696 CTGGATATGGAGAAGAAATCAGG - Intergenic
1138288613 16:55828975-55828997 CTGGACATGGAGAATAAATCAGG + Intronic
1138948983 16:61887572-61887594 CCTTACATGAAGAGGAAATCCGG - Intronic
1140489755 16:75325257-75325279 CTGTGCTAGGAGAGGAAGTCTGG - Intronic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1142022126 16:87790377-87790399 TTGTACAGGGAGAGGACCTCAGG - Intergenic
1142055412 16:87992208-87992230 CAATACATGTAGATGAAGTCAGG - Intronic
1142194435 16:88732992-88733014 CTGGACAGGGAGAGACAGTCAGG - Intronic
1142232109 16:88904851-88904873 CTGTACATGTGGAGGAAGCCAGG + Intronic
1142511124 17:394081-394103 CTGTTCATGGAGAGGGAGCGAGG - Intergenic
1151822823 17:76506379-76506401 GCATATATGGAGAGGAAGTCTGG - Intergenic
1157843247 18:50978814-50978836 CTGGACCTAGAGAAGAAGTCAGG + Intronic
1158120038 18:54038917-54038939 CTTTAGTTGGAGTGGAAGTCTGG + Intergenic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
1160100189 18:75913581-75913603 CTTTACTTGGAGAGTAAGTATGG + Intergenic
1164854033 19:31506990-31507012 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854048 19:31507056-31507078 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854063 19:31507122-31507144 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854078 19:31507188-31507210 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854093 19:31507254-31507276 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854108 19:31507320-31507342 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854123 19:31507386-31507408 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1164854138 19:31507451-31507473 GTGTAGATGGAGAGGAAGCAGGG - Intergenic
1166100781 19:40570385-40570407 CTGTCCATGGAGAGGGTGTGGGG - Intronic
1166262318 19:41649072-41649094 CTGTACATGTATAGAAGGTCAGG - Intronic
1167247837 19:48384409-48384431 CTGTTCATGGTGAGCAAGACCGG - Exonic
1167360638 19:49028644-49028666 CTGCACTTGAAGAGGAACTCTGG - Intronic
1167363013 19:49040155-49040177 CTGCACTTGAAGAGGAACTCTGG + Intergenic
1167365556 19:49053431-49053453 CTGCACTTGAAGAGGAACTCTGG - Intergenic
1167367747 19:49063935-49063957 CTGCACTTGAAGAGGAACTCTGG - Intronic
925443758 2:3910137-3910159 CTGTGCCTGGAGAGGAAGGTTGG - Intergenic
925743903 2:7029001-7029023 CCCCACAAGGAGAGGAAGTCCGG + Intronic
929873168 2:45774847-45774869 CTGGACTTGGAGACGAACTCAGG - Intronic
931150196 2:59564703-59564725 CTGCTCATGGAGAGGAAGCAAGG - Intergenic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
933605206 2:84375447-84375469 CTGAACATGGAGAGTAAGCAAGG + Intergenic
936064593 2:109320800-109320822 CTGTACATGGACAGGCAGAGTGG + Intronic
937053474 2:118911303-118911325 CAGTTCATGGAGAGGAGGCCTGG + Intergenic
937316523 2:120935251-120935273 CTGGAGATGGAGAGGCAGTGTGG - Intronic
937536799 2:122898864-122898886 AAGTAAATGGAGAGGAAGGCTGG - Intergenic
938459829 2:131490322-131490344 CCCTACCTGGACAGGAAGTCTGG - Intronic
940900824 2:159124862-159124884 CTGTACTTGGTGAGGAGGGCGGG - Intronic
941840710 2:170080654-170080676 ATGCTCATGGAGAGGAAGACCGG + Exonic
943411028 2:187548279-187548301 CTTCACATGGGGAGGAAGTTGGG - Intronic
945128391 2:206539056-206539078 CAGTATATGAAGAGGAAGCCTGG + Intronic
948466074 2:238152193-238152215 CTGGTCCTGGAGAGGAAGCCTGG - Exonic
948757383 2:240167484-240167506 CTGCCCAGGGTGAGGAAGTCCGG - Intergenic
1169152804 20:3303909-3303931 ATGGAGCTGGAGAGGAAGTCTGG + Intronic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1169925369 20:10778037-10778059 CTGCACATGGAGATGAACTCAGG + Intergenic
1171948247 20:31397458-31397480 CTGTTTTTGGAAAGGAAGTCAGG - Intergenic
1172325334 20:34030064-34030086 AAGTATATGGAGAGGATGTCAGG + Intronic
1172697216 20:36831171-36831193 ATGTACATAGAGATGGAGTCTGG - Intronic
1173860144 20:46277890-46277912 CGGTAGCTGGAGAGGAAGGCAGG + Intronic
1175338537 20:58212623-58212645 CTGTACATACAGATCAAGTCAGG + Intergenic
1176062347 20:63177942-63177964 CTGTTCGTGGAGAGAAAGACGGG - Intergenic
1177805599 21:25871822-25871844 CTGCACATGGAGAGGAACTGAGG - Intergenic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1183600137 22:38835331-38835353 CTGTCCCTGGAGAGGAAGGCAGG - Intronic
1183641742 22:39097035-39097057 CTGTACCTGGAGAGGGAATTGGG + Intergenic
1184438747 22:44496339-44496361 GTGTACCTGGAGAGGGGGTCTGG - Exonic
951013979 3:17709261-17709283 CTGTACATGTAAAGGCAGACTGG + Intronic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
952161277 3:30695778-30695800 ATGTGAATGGAGAGGAAGTCAGG - Intergenic
952948747 3:38500208-38500230 CTGTGCATCGAGAGGAGATCAGG + Intronic
954013000 3:47659650-47659672 CTGTGCATGTAGGGGTAGTCAGG + Intronic
956259891 3:67327847-67327869 CATTAAATGGAAAGGAAGTCAGG - Intergenic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
961466618 3:127085620-127085642 CTGTGCAGGGAGAGGGAGTCTGG + Intergenic
962032925 3:131620434-131620456 CTGAACATGGTGAGTAACTCAGG - Intronic
962477991 3:135773719-135773741 CTGCACAGAGAGAGGAAGTCTGG + Intergenic
964001067 3:151772593-151772615 CTATTCCTGAAGAGGAAGTCAGG - Intergenic
964021224 3:152013876-152013898 AGGTACATGTAGAGGAATTCTGG - Intergenic
965736043 3:171822222-171822244 CTGTACTTGGGGAGGTAGGCGGG + Intergenic
967144496 3:186595012-186595034 CTGTGCATGGAGACCAGGTCGGG + Intronic
967223292 3:187267426-187267448 CTATACAGGGAAAGAAAGTCTGG - Intronic
969953034 4:10858830-10858852 CTGTATATGGTGAGGACCTCAGG - Intergenic
971036274 4:22696231-22696253 CTGTAGATGCATTGGAAGTCAGG + Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
977580451 4:98718981-98719003 CTGAACATGGAAAGGAAACCAGG + Intergenic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
978322238 4:107510463-107510485 CTGTGTATGGAGAGGTAGTTAGG + Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
978642273 4:110884716-110884738 ATGTATATGAAGAGAAAGTCAGG - Intergenic
978642370 4:110885950-110885972 ATGTATATGAAGAGAAAGTCAGG + Intergenic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
985368904 4:189264070-189264092 CAGTAAATGGGGATGAAGTCAGG + Intergenic
985764246 5:1768496-1768518 CTGTCCAGGGAAAGGAATTCAGG + Intergenic
986304631 5:6506233-6506255 CTGAACATGGGGTGGAAGTGCGG + Intergenic
987271986 5:16319532-16319554 TTGTAAATGGAGAGTAAGCCGGG - Intergenic
987834933 5:23147622-23147644 CTTTACATGGTGAGGAAAACAGG - Intergenic
994997998 5:107089369-107089391 CTGTACCTGGACAGGGAGTGGGG - Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
999707308 5:154285374-154285396 CTGTCCATAGAAAGCAAGTCAGG - Intronic
1004891072 6:20101277-20101299 CTGTACATGGAGCTGAAGAGGGG - Intergenic
1005755585 6:28923019-28923041 CTGTAGCTGGCGAGGAAGCCAGG - Intronic
1007373586 6:41442319-41442341 CTGTAGGAGGAGAGGAAGTAGGG + Intergenic
1007982483 6:46172888-46172910 TTGTTCATGGGGAGAAAGTCTGG + Intergenic
1009320157 6:62278317-62278339 CTGTACAAGGGGAGGAAGTGAGG - Intronic
1010607722 6:77912000-77912022 TTGTATATGGAGAGGTAGTGGGG + Intronic
1012437871 6:99234353-99234375 CTTTGCATGGAAGGGAAGTCAGG - Intergenic
1013130121 6:107224568-107224590 CTGTATATGCAGAGGTAGTCAGG - Intronic
1013425577 6:110009682-110009704 CTAAACATAGAGAGGAAGGCTGG - Intergenic
1014871892 6:126606232-126606254 CTGTAGATTGAAAGGAACTCAGG + Intergenic
1016793312 6:148089729-148089751 CTGTGCATTGGGAGGAAGACTGG - Intergenic
1016937664 6:149459566-149459588 GTGGAGATGGAGTGGAAGTCGGG + Intronic
1017441555 6:154468802-154468824 CTGTACACAGAGAGGAAATCAGG - Intronic
1019997010 7:4731124-4731146 CTGTGCAGGGACAGGAAGTCAGG - Intronic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1023040169 7:36165993-36166015 CTGTAAACGGAGAGGGATTCAGG + Intronic
1025176053 7:56803018-56803040 CTGGAAATGGAGAGGACTTCAGG + Intergenic
1025695741 7:63773404-63773426 CTGGAAATGGAGAGGACTTCAGG - Intergenic
1029883077 7:103837352-103837374 GTGTACAGGGAGAGCAAGTAGGG - Intronic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1033933562 7:146554578-146554600 TTGTACATGGAGATGAAGGATGG + Intronic
1034690693 7:153011284-153011306 CTGTATTTTCAGAGGAAGTCAGG + Intergenic
1035868184 8:3108100-3108122 CTGCACATGGACAGGGAGCCAGG - Intronic
1037160106 8:15759307-15759329 CTTAAACTGGAGAGGAAGTCAGG - Intronic
1038327112 8:26579576-26579598 TTGTGCACGGAGAGGAAGCCGGG - Intronic
1041126335 8:54644085-54644107 CTGTGAATGGAGAGGAATTTTGG - Intergenic
1048336148 8:133503971-133503993 CTGTACATGGAGAGGAGGGGAGG + Intronic
1050029389 9:1369168-1369190 ATGTGCATGGAGAGGAAGACAGG + Intergenic
1054966530 9:71034240-71034262 CTGAACTTGGTCAGGAAGTCTGG + Intronic
1055030496 9:71768444-71768466 CTGGCCATGGAGAGGAGATCTGG - Exonic
1056286608 9:85093474-85093496 CTTTACATAGAGAGGCAGTTGGG + Intergenic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1057467549 9:95329463-95329485 TTGTACAAGGAGAAAAAGTCTGG + Intergenic
1058574989 9:106391289-106391311 CTCAAAATGGAGAGGAAATCAGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1203784666 EBV:120833-120855 TTGTACATGGACACGTAGTCCGG + Intergenic
1186965164 X:14779112-14779134 CTGATCATGCAGAGGAACTCTGG - Intergenic
1188475821 X:30590618-30590640 CTCTCCATAGAGAGGAAATCTGG - Intergenic
1188650130 X:32622142-32622164 CTGTAAGTGGAGGTGAAGTCAGG - Intronic
1189392135 X:40585251-40585273 CTTTACATGGAGAGGATGAGAGG + Intronic
1190477039 X:50838887-50838909 CTGTACATAGAGAGGAAATATGG - Intergenic
1195175650 X:102312986-102313008 ATGTACATGGACAGGAAGGAAGG + Intronic
1195183214 X:102374107-102374129 ATGTACATGGACAGGAAGGAAGG - Intronic
1195407390 X:104530580-104530602 CTGAAGATGGAGAGCAAGTTTGG - Intergenic
1199675022 X:150181530-150181552 GTGGGCCTGGAGAGGAAGTCAGG - Intergenic
1199780318 X:151052250-151052272 CTGTACATGGGTAGGAACTATGG + Intergenic
1201147738 Y:11074138-11074160 CTGAACAGGGAGAGAAACTCAGG - Intergenic