ID: 1114186355

View in Genome Browser
Species Human (GRCh38)
Location 14:20405423-20405445
Sequence GAGGTGTGAAGGAGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 1038}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114186355_1114186364 0 Left 1114186355 14:20405423-20405445 CCCCATCCCCTCCTTCACACCTC 0: 1
1: 0
2: 6
3: 108
4: 1038
Right 1114186364 14:20405446-20405468 AATACCTTGAGGATAAACTCAGG 0: 1
1: 0
2: 1
3: 8
4: 155
1114186355_1114186366 7 Left 1114186355 14:20405423-20405445 CCCCATCCCCTCCTTCACACCTC 0: 1
1: 0
2: 6
3: 108
4: 1038
Right 1114186366 14:20405453-20405475 TGAGGATAAACTCAGGCTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 219
1114186355_1114186368 11 Left 1114186355 14:20405423-20405445 CCCCATCCCCTCCTTCACACCTC 0: 1
1: 0
2: 6
3: 108
4: 1038
Right 1114186368 14:20405457-20405479 GATAAACTCAGGCTCCAGGAGGG 0: 1
1: 0
2: 3
3: 27
4: 249
1114186355_1114186367 10 Left 1114186355 14:20405423-20405445 CCCCATCCCCTCCTTCACACCTC 0: 1
1: 0
2: 6
3: 108
4: 1038
Right 1114186367 14:20405456-20405478 GGATAAACTCAGGCTCCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114186355 Original CRISPR GAGGTGTGAAGGAGGGGATG GGG (reversed) Intronic
900019666 1:180342-180364 GAGGTGTGAGGGTGAGGATGAGG - Intergenic
900236795 1:1596926-1596948 CAGGTCAGAAGGAGGGGTTGGGG + Intergenic
900462078 1:2806356-2806378 AAGGTGTGAAGGAAGGAAAGAGG + Intergenic
900636118 1:3666601-3666623 GAGGTGGGCAGGAGGTGGTGGGG - Intronic
900661562 1:3787037-3787059 GAGGCGGGAAGGTGGTGATGGGG - Exonic
900792144 1:4687760-4687782 GAGGTGTCAAGGAAGGGCAGGGG + Intronic
900807785 1:4779106-4779128 GATGTGTGTAGGAAGGAATGGGG + Intronic
900877306 1:5352204-5352226 AAGGTGAAAATGAGGGGATGGGG + Intergenic
901203073 1:7477666-7477688 GAGGGGTGAAGGAAGGAATCGGG - Intronic
901206221 1:7497340-7497362 GAGGTTTGGAGGATGGGATGGGG - Intronic
901221376 1:7585843-7585865 GAGGTGGGAGGCAGGGGAGGTGG - Intronic
901380195 1:8868068-8868090 GAGGGGAGAATGAGGGGTTGGGG + Intronic
901429121 1:9201753-9201775 GAGGAGGGAAGGAGGGAAGGAGG - Intergenic
901643631 1:10705359-10705381 GAGATGAGAAGGTGGAGATGGGG - Intronic
901740381 1:11338168-11338190 GAGGGGAGAAGGAGGAGAAGGGG - Intergenic
901833037 1:11905771-11905793 GAGGAGTGAAGGAGGAAGTGGGG - Intergenic
902090144 1:13896652-13896674 ATGGTGTGAAGGTGGGCATGCGG - Intergenic
902231101 1:15028188-15028210 GAGGTGGGAGGGAGGGTGTGTGG - Intronic
902525293 1:17053536-17053558 GGGGTGTGAAGGATGGGAATTGG - Intronic
902550981 1:17219488-17219510 GCCCCGTGAAGGAGGGGATGAGG + Intronic
902827842 1:18989324-18989346 CATGTGTGAAGGAGGGGGAGAGG + Intergenic
902882223 1:19379959-19379981 GATGTGGTCAGGAGGGGATGCGG - Intronic
903684429 1:25120449-25120471 GTGCTGAGAAGGAGGGGCTGAGG - Intergenic
903955591 1:27023146-27023168 CAGGTGAGAAGGGTGGGATGTGG - Intergenic
904277494 1:29393935-29393957 GAAGGGAGAAGGAGGGGAGGAGG - Intergenic
904413789 1:30342700-30342722 GAGGCGTGGAGGAGGGGAGAGGG - Intergenic
904447669 1:30587904-30587926 CAGCTTTGAAGGGGGGGATGGGG - Intergenic
904494230 1:30877715-30877737 GAGATGGGGAGTAGGGGATGGGG + Intronic
904599559 1:31666015-31666037 GGTGAGTGAAGGAGGGCATGGGG - Exonic
904881211 1:33698567-33698589 GAGGTGTGAAAGTGAGGAAGTGG + Intronic
904891228 1:33781088-33781110 AAGTTCTGAAGAAGGGGATGTGG + Intronic
904940800 1:34164208-34164230 GGGATGGGAAGGAGGGGGTGGGG - Intronic
905620470 1:39441123-39441145 GAGGTGTGGAGAAATGGATGAGG + Exonic
905869390 1:41394515-41394537 GAGCTCGGGAGGAGGGGATGGGG + Intergenic
905892767 1:41527633-41527655 GGTGTGTGAGGGTGGGGATGTGG - Intronic
906001512 1:42430351-42430373 GAGGGGTAAAGGAGGGGGTAGGG - Exonic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
906187260 1:43871465-43871487 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187266 1:43871484-43871506 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187272 1:43871503-43871525 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187278 1:43871522-43871544 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187296 1:43871577-43871599 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187320 1:43871672-43871694 GGGGTGTGAGGGAGAGGATGGGG + Intronic
906187326 1:43871691-43871713 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187343 1:43871745-43871767 GGGGTGGGAGGGAGAGGATGAGG + Intronic
906187358 1:43871802-43871824 GGGGTGTGAGGGAGAGGCTGGGG + Intronic
906187370 1:43871837-43871859 GAGGGGTGTGGGAGAGGATGGGG + Intronic
906196344 1:43932850-43932872 GAGGTCTGATGCAGGGCATGAGG - Intergenic
906257840 1:44364293-44364315 GAGGTGGGAAGGTGGGAAGGTGG - Intergenic
906939102 1:50240103-50240125 GCGGTGTGAAGCAGGGGGAGTGG + Intergenic
907045921 1:51299971-51299993 GAGGTGATGAGGAGGGGGTGTGG + Intronic
907126919 1:52058530-52058552 GAGATGTGAGGGAGGGAATAAGG - Intronic
907325207 1:53633453-53633475 GGGGTGTGAATGAGTGGCTGAGG + Intronic
907357586 1:53889304-53889326 GAGGTTTGAAAGAGGTGATGGGG + Exonic
907537797 1:55180743-55180765 GTGCTGTGAAGGAGAGGTTGAGG - Intronic
907623377 1:56005075-56005097 GAGGAGAGAAGGAGGGGATGTGG - Intergenic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
908002031 1:59689884-59689906 CAGGTGTCAGGGAGGGGTTGGGG - Intronic
908260503 1:62336529-62336551 GAGGAGTGGAGGATGGGAGGAGG - Intergenic
909395796 1:75169474-75169496 GAGGTGTGAATGAGGAGAGTGGG + Intergenic
909431052 1:75588241-75588263 AAGGAGTGAAGGAGGGAAGGAGG + Intronic
909561799 1:77016065-77016087 GAGTGGAGAAGGAGGGGATGTGG - Intronic
910482504 1:87674057-87674079 GAGGGATGAAGATGGGGATGAGG + Intergenic
910655555 1:89614784-89614806 GAGGTGTGAGGGTGGGCCTGTGG - Intergenic
911768607 1:101710536-101710558 AAGATGAGAAGGAGGGGAGGGGG - Intergenic
912262836 1:108126371-108126393 GAGGTGGGAAGGGGCGGAAGAGG - Intergenic
912789053 1:112633232-112633254 GAGGGGTCAGGGAAGGGATGGGG - Intronic
913084201 1:115420378-115420400 CAGGGGTGAAGGAGTGGGTGGGG - Intergenic
914472956 1:147999036-147999058 GAGCGGGGAAGGAGGTGATGAGG + Intergenic
914981314 1:152416604-152416626 GAAGTGTGCAGGTGGGGCTGGGG + Intergenic
915240289 1:154516357-154516379 AAGGTGGGAAGGAAGGGATCGGG + Intronic
915271404 1:154756191-154756213 GAGGGGAGGAGGAGGGGTTGGGG + Intronic
915595438 1:156893996-156894018 GAGACGTGAAGGAGGGGAAGGGG + Intronic
915612376 1:157004764-157004786 GGGATGTAAAGGAGGGAATGAGG - Intronic
917005795 1:170415992-170416014 GAGGAGGCAAGAAGGGGATGGGG - Intergenic
917117442 1:171616599-171616621 CAGGTTTGAAGGAGGTGATCAGG + Intergenic
917222091 1:172742896-172742918 GAGGGGTGAAAGTGGGGAGGAGG + Intergenic
917694549 1:177508540-177508562 GGGGTGTGTAGGTGGTGATGAGG - Intergenic
918189937 1:182164187-182164209 GAGGGGAAAAGAAGGGGATGTGG - Intergenic
919132931 1:193473756-193473778 AAGATGTAAATGAGGGGATGGGG + Intergenic
919303957 1:195806181-195806203 GTGGTGTGAAGGAGAGGAACTGG + Intergenic
919481089 1:198090683-198090705 GAGGTGAGAAGGAGGGAAACAGG + Intergenic
919750558 1:201034996-201035018 GAAGTGGGAGGGAGGGGAAGTGG - Intergenic
920671661 1:208008418-208008440 AAGGTGGGAAAGAGAGGATGAGG - Intergenic
920835095 1:209503051-209503073 TAGGTATGAAGGTGTGGATGGGG + Intergenic
920966304 1:210704191-210704213 GAAGTCTGAAGGAAGGGAGGGGG + Intronic
921337352 1:214101447-214101469 GAGGTCTGAAGGTGGAGCTGTGG + Intergenic
921824854 1:219660961-219660983 GGAGTGTGAAGTGGGGGATGTGG + Intergenic
922101594 1:222481836-222481858 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
922131691 1:222786700-222786722 TAGGTTTTAAGGAGGGGATAAGG - Intergenic
922201376 1:223404409-223404431 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
922262675 1:223956952-223956974 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
922272052 1:224043556-224043578 GGGGTGTGCTGGAGGGGAGGGGG - Intergenic
922528832 1:226327402-226327424 CAGGTGTGTAGGGGGGGGTGGGG + Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
922825845 1:228517913-228517935 GAGGAGGGAAGAAGGGGAAGGGG - Intergenic
922892637 1:229073390-229073412 TAGGAGGGAAGGAGGGGAGGAGG + Intergenic
923106224 1:230855993-230856015 GAGATGAGTAGGAGTGGATGAGG + Intronic
923687175 1:236161362-236161384 GAGCAGTGAGGGAGGGGGTGAGG - Intronic
924154729 1:241164165-241164187 GAGGTATGGAGGAAGGGTTGTGG + Intronic
924344514 1:243061953-243061975 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
924444652 1:244118010-244118032 TAGGTGTGAGGAAGGGGATTTGG + Intergenic
1062818174 10:516362-516384 GGGAGGGGAAGGAGGGGATGGGG + Intronic
1062904652 10:1171692-1171714 GAGGGGAGCAGGAGGGCATGAGG - Intergenic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1064247992 10:13684477-13684499 TGGGTGTGGAGGAGCGGATGTGG + Intronic
1064487714 10:15813109-15813131 GAGGTGGGAAGGAAGGGAACAGG - Intronic
1064541439 10:16409606-16409628 AAGGAGTGAAGGAGGGAGTGAGG + Intergenic
1064965451 10:21011555-21011577 GAGGAGAGAAGGAGGGAATGTGG - Intronic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065367518 10:24951008-24951030 GCGGTGTGATGGATGGGAGGGGG - Intronic
1065708006 10:28488922-28488944 GAGGTGTGAATGCAGGCATGTGG + Intergenic
1065828883 10:29596642-29596664 GGGAGGTGCAGGAGGGGATGGGG - Intronic
1066535560 10:36387230-36387252 GAGGTGTGAAGTAGGGGAAAGGG + Intergenic
1066563866 10:36699174-36699196 GAGGTATGATGTAGGGGATAAGG - Intergenic
1066731819 10:38443119-38443141 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1067214765 10:44293020-44293042 GAGGTGGGGAGGTGGGGAGGGGG + Intronic
1067251773 10:44592823-44592845 GGGATGTGATGGTGGGGATGAGG + Intergenic
1067299774 10:44997768-44997790 GAGGTATGAAGGAAAGGGTGCGG + Exonic
1067480935 10:46597393-46597415 GAGGGGGGAAGGGGGGGTTGGGG - Intergenic
1067825554 10:49570089-49570111 AAGATGGGGAGGAGGGGATGTGG - Intergenic
1067979960 10:51074070-51074092 GAGGTGGGAGGGAGGGGACAGGG - Intronic
1068445670 10:57119378-57119400 GAGGTGTGAAGTGGGAGATCAGG - Intergenic
1068544044 10:58326898-58326920 GGGGTGTGGAGGCGGGGGTGGGG - Intergenic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1068558179 10:58481933-58481955 GAGGAGGAAGGGAGGGGATGAGG - Intergenic
1069176084 10:65290165-65290187 GAGGAGTGAAGGAGGGAGGGAGG - Intergenic
1069212473 10:65779294-65779316 GAGGTGGGATGGAGGGGCTGAGG + Intergenic
1069350825 10:67524753-67524775 CATGTGTGCAGGTGGGGATGGGG - Intronic
1069753227 10:70758089-70758111 GAGGTGAGCCAGAGGGGATGGGG + Exonic
1069807787 10:71136771-71136793 GAAGTGTGAAGCAGGGAAGGAGG + Intergenic
1070325168 10:75384131-75384153 GAGGTGTGGGGCAGGGGATGCGG + Intergenic
1070642417 10:78179329-78179351 GAGGGGAGAAGGATGGGAGGTGG + Intergenic
1070711868 10:78689000-78689022 GAGGAGAGGAGGAGGGAATGGGG - Intergenic
1070891804 10:79946753-79946775 GAGGACAGAAGGAGGGAATGGGG - Intronic
1071355603 10:84790442-84790464 AAGATGTGAAGGAGGAGATGAGG + Intergenic
1071880413 10:89890839-89890861 AGGGTGTGAAGGAAGGGATGAGG - Intergenic
1072633221 10:97161202-97161224 GTGCTGGGAAGGAGGGGAGGAGG - Intronic
1072719242 10:97770824-97770846 GAGAGGTGAGGGAAGGGATGTGG - Intronic
1072810589 10:98458374-98458396 CAGGTGTGAAGTGGGGGATGAGG - Intronic
1073042532 10:100617410-100617432 GAGGAGTCCAGGTGGGGATGGGG - Intergenic
1073075449 10:100823368-100823390 GACGTGTCAAGGTAGGGATGAGG + Intronic
1073116346 10:101093959-101093981 GAGGTGTGCAGGAGGGGTGGGGG + Intronic
1073257153 10:102160057-102160079 TGGGTCTGGAGGAGGGGATGAGG + Intronic
1073445286 10:103576704-103576726 GAGGGTTCTAGGAGGGGATGAGG + Intronic
1073455131 10:103632180-103632202 GAGGTGTGGACAAGGGTATGTGG - Intronic
1074107846 10:110401778-110401800 GAGGTGTGGAGCAAGGGGTGGGG + Intergenic
1074293393 10:112158868-112158890 GTGGTGGGATGGAAGGGATGAGG - Intronic
1074495070 10:113973022-113973044 GAGGTGGGAAGGAGAGGGTTGGG - Intergenic
1074580842 10:114717917-114717939 GAGGAGAGAAGGGGGGGAAGGGG + Intergenic
1075281467 10:121142458-121142480 GAGAAGAGAAGGAGGGGATGAGG + Intergenic
1075670492 10:124260996-124261018 TTGGAGTGAAGGAGGGGAGGAGG - Intergenic
1075704858 10:124494547-124494569 CAGGTGGGCAGGAGGGGACGAGG + Intronic
1076116369 10:127904554-127904576 GAGGTGTTCAGGAGGGCAAGAGG + Intergenic
1076542645 10:131223933-131223955 GAGGGGAGAAGGTGGGGATGTGG - Intronic
1076571950 10:131438886-131438908 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
1076656315 10:132026060-132026082 GAGGTGAGAAGGAAGTGAGGTGG + Intergenic
1076903205 10:133350052-133350074 GAAGTGTGAGGTAGGGGAAGGGG - Intronic
1078390879 11:10934326-10934348 GGGGTTGGAAGGAGGGGTTGGGG + Intergenic
1078442454 11:11378882-11378904 GAGGTGTGGTAGAGGGGAGGGGG - Intronic
1078719631 11:13872503-13872525 GAGGTTGGCAGGAGGTGATGGGG - Intergenic
1079103684 11:17557348-17557370 GAGGGGTGTTGGTGGGGATGGGG + Intronic
1079248958 11:18773322-18773344 GGGGTGTGAGGAAGGGGAGGGGG + Intronic
1079323807 11:19474586-19474608 ATGGAGTGAAGGAGTGGATGAGG + Intronic
1079817191 11:25076549-25076571 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
1081512969 11:43795042-43795064 GAGGTGTGAAGATGGAAATGAGG + Intronic
1081664179 11:44906776-44906798 GAGTGGGAAAGGAGGGGATGGGG + Intronic
1081732095 11:45378775-45378797 GAGGTTGTAGGGAGGGGATGAGG + Intergenic
1082013882 11:47469893-47469915 GCGGAGAGAAGAAGGGGATGTGG + Intronic
1082734881 11:56845172-56845194 GAGGTGTGGAGGGGGAGGTGTGG + Intergenic
1082792837 11:57359250-57359272 AGGGTGGGAAGGAGGGGATGGGG - Intronic
1083408117 11:62472507-62472529 GAGGCGGGAAGGAGGAGATTTGG - Intronic
1083421245 11:62554466-62554488 AAGGGGTGAAGGAGGGAATGTGG - Intronic
1083452886 11:62757945-62757967 GAGGTATGGGGGAAGGGATGTGG + Intergenic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083598877 11:63933886-63933908 GCGGTGTGAGGGAGTGGATAAGG - Intergenic
1083664368 11:64266581-64266603 GATGAGTGAAGGAAGGGAGGTGG - Intronic
1083955735 11:65981984-65982006 CAGGTGTGAAGGATGGGACGAGG + Intergenic
1084187960 11:67485090-67485112 GCAGAGTGAAGGAGGGGGTGGGG - Intronic
1084381635 11:68816598-68816620 GGGGGGTCCAGGAGGGGATGGGG - Intronic
1084471739 11:69365686-69365708 GAGGGGTGGAGGAGGAGAAGCGG + Intronic
1084537941 11:69768852-69768874 GAGGTGTGGGGGTGGGGGTGGGG - Intergenic
1084867266 11:72069414-72069436 GAAGTGAGAAGCAGGGGAGGAGG - Intronic
1085047585 11:73362548-73362570 GAGATGTGAAGGCAGGGCTGCGG - Exonic
1085426441 11:76408827-76408849 GGGGTGTGAGTGAGGGGATCAGG + Intronic
1085736770 11:79045845-79045867 CAGGAGTGAAGGAGTGGGTGGGG - Intronic
1088735685 11:112725887-112725909 GATGTGGGAAGAAGGGAATGGGG + Intergenic
1089191916 11:116659801-116659823 GAGGTGTGAATGCAGGTATGGGG - Intergenic
1089673879 11:120075969-120075991 GGGGTGGGGAGGAGGGGAGGTGG + Intergenic
1090037251 11:123259748-123259770 GAGGTGTGAAGTAGGAAATCAGG - Intergenic
1090410138 11:126502343-126502365 GAGGAGTGGAGGAGGGGCTGTGG - Intronic
1090423924 11:126594103-126594125 GAGGGGTGGAGGATGGGAGGAGG - Intronic
1090469732 11:126969473-126969495 CAGGTGTGAACCAGGGGAAGAGG + Intronic
1090752391 11:129759047-129759069 GAGGTGGTGAGGAGGGGATTAGG + Intergenic
1090867242 11:130711845-130711867 GAGGTGTGAAGGAAGCCAAGAGG - Intronic
1091034085 11:132217688-132217710 GAGGTGGGAAGGAAGAGATCTGG - Intronic
1091070519 11:132558423-132558445 GAGGAGGGGAGGAGGGGAGGAGG - Intronic
1091400340 12:177354-177376 GAGGTGGGAGGGAGGGCCTGGGG - Exonic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091858871 12:3760865-3760887 GGGATGTGCAGGAGGGGAGGAGG - Intronic
1092196501 12:6552645-6552667 GATGTGTGAAAGAGGGCAGGAGG + Intronic
1092287080 12:7134858-7134880 GAGGACTGATGTAGGGGATGAGG - Intronic
1092598166 12:10030387-10030409 GAGGTGTGAAGTGGGAAATGAGG - Intergenic
1092805296 12:12216814-12216836 AGGGTGTGTGGGAGGGGATGTGG - Intronic
1092964617 12:13629618-13629640 GAGGAGGGAAGGAGGGAAAGAGG - Intronic
1093012457 12:14123292-14123314 CAGGAATTAAGGAGGGGATGGGG + Intergenic
1093081909 12:14822010-14822032 GGGGTGGGGAGTAGGGGATGGGG + Intronic
1094190588 12:27694148-27694170 CAGGTGTGAAGGGTGGGGTGGGG - Exonic
1094475915 12:30840422-30840444 GAGGTGTGAGGGTGGGTGTGCGG + Intergenic
1095451547 12:42336720-42336742 GAGGTCTAAAGGAGGGTTTGGGG + Intronic
1095991299 12:48036432-48036454 GAGGTGGGTGGGAGGCGATGTGG + Intergenic
1096761768 12:53847739-53847761 GAGGAAGGAAGGCGGGGATGAGG - Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097086475 12:56472091-56472113 GAAGGGTTAAGGAGGGGAGGAGG - Exonic
1097200290 12:57272599-57272621 GAGGTGGGAAGCGGGGGGTGGGG + Intronic
1097816062 12:64075086-64075108 GAGGTGTGAAGTAGGAAATCAGG + Intronic
1097971716 12:65640057-65640079 GGGGTGGGAAGGAAAGGATGGGG - Intergenic
1098246640 12:68525695-68525717 GAGGTGTGAAGTGGGGAATCAGG - Intergenic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1099970089 12:89491233-89491255 GAGATGTAAAGGAGGGAGTGAGG - Intronic
1100137079 12:91566865-91566887 GAGAAGTGAAGGAGGGGAGGAGG - Intergenic
1100454584 12:94740146-94740168 GAGGTGTTTAGGAGGTAATGGGG + Intergenic
1100816921 12:98395699-98395721 GAGCTGTGAAGCAGGCCATGGGG + Intergenic
1100875413 12:98956548-98956570 TAGGAGTGACGGGGGGGATGGGG - Intronic
1101223836 12:102667752-102667774 GAGGTGTGAAGGGGGAAATCAGG + Intergenic
1101348612 12:103907318-103907340 GAGGGGAAAAGGAGGGGAGGGGG + Intergenic
1102061881 12:109938775-109938797 GAAGGGTGAAGGAGGGGAAAAGG + Intronic
1102167878 12:110820793-110820815 GGGGAGAGAAGGAGGGGGTGAGG - Intergenic
1102503145 12:113366771-113366793 GAGGAGGGAAGGAGGGGAGTGGG - Intronic
1102517519 12:113459850-113459872 GAGGGGTGAAAGAGAGGAAGAGG - Intergenic
1102680287 12:114686305-114686327 CAGGTGGGGAGGAGGGGATGCGG - Intergenic
1102851230 12:116246881-116246903 GAGGTGGGGAGGTGGGGAGGCGG + Intronic
1102864968 12:116367220-116367242 GAGCTGTGAGTGAGAGGATGTGG + Intergenic
1103349872 12:120276714-120276736 GAGGTGAAAATGAGGGGGTGGGG - Intergenic
1103425566 12:120830492-120830514 GAGGGGGGAAGAAGGGGAGGGGG + Intronic
1103882312 12:124175573-124175595 GAGGTATGAATGGAGGGATGAGG - Intronic
1104096702 12:125564934-125564956 GAGGTGTGAAGGATGAGTAGGGG + Intronic
1104346816 12:128007488-128007510 GTGGTTTGAAGGGGAGGATGTGG + Intergenic
1104427968 12:128693628-128693650 CAGGGGTGAAGGAGCAGATGAGG - Intronic
1104470354 12:129025090-129025112 GAGGTGTGTGTGTGGGGATGTGG - Intergenic
1104485533 12:129148742-129148764 CAGCTGTGGAGGAGGGGATGGGG - Intronic
1104639446 12:130458071-130458093 GAGGGGCGGAGGAGGGGAGGGGG - Intronic
1104787642 12:131459876-131459898 GCAGTCTGGAGGAGGGGATGGGG + Intergenic
1104947359 12:132422051-132422073 ACAGTGAGAAGGAGGGGATGGGG + Intergenic
1105384884 13:19920528-19920550 GAGACGGGAAGGAGAGGATGGGG + Intergenic
1105448760 13:20479994-20480016 TAGGTGTTAGGGAGTGGATGGGG - Intronic
1105599938 13:21877675-21877697 AAGGGGTGAAGGTGGGGATTCGG - Intergenic
1105711218 13:23010938-23010960 GAGGTGTGAAGTGGGAAATGAGG - Intergenic
1105966712 13:25391253-25391275 GAAGTATGAAGGAGGAGATAAGG - Intronic
1106005056 13:25761818-25761840 GAGGTGTTATGCAGGGGCTGGGG + Intronic
1106799952 13:33246023-33246045 GAAGGGTGCAGGAAGGGATGGGG + Intronic
1106836165 13:33637291-33637313 GTGGCCTGAAGGAGGGGAAGAGG + Intergenic
1107300719 13:38963094-38963116 CAGTAGTGAAGGAGGGCATGGGG - Intergenic
1107781481 13:43907848-43907870 GTGCTGTGTAGGAGGGGATTCGG + Intergenic
1107828236 13:44350218-44350240 GGGGTGTCAAGGAGTGGGTGTGG - Intergenic
1107852725 13:44587211-44587233 AAGGTCTGAGGGAGGGGGTGGGG + Intergenic
1107977316 13:45702907-45702929 GAGTTTTGAAGGAGGAGATGGGG - Intronic
1108167874 13:47711676-47711698 GAGGGAGGAAGGAGGGCATGGGG - Intergenic
1108588438 13:51891563-51891585 GAGGTGGTGAGGAGGGGATTGGG + Intergenic
1108750113 13:53439852-53439874 GATGGGGGAAGGTGGGGATGGGG - Intergenic
1109621382 13:64911553-64911575 GAGCTGTAATGGAGGGGCTGAGG - Intergenic
1110486618 13:76051978-76052000 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
1110682706 13:78335159-78335181 GAGGTGGGAAGTAGGAGAGGAGG - Intergenic
1110863117 13:80365982-80366004 GAGGGGGGAAGGTGGGGAAGGGG + Intergenic
1111230806 13:85341559-85341581 GAGGGGTGGAGGAGGGGGAGGGG + Intergenic
1111759068 13:92438787-92438809 TAGGTGTGAAGGAGGAAAGGAGG + Intronic
1112432411 13:99361729-99361751 GTTATGTGAAGGAGGGGAGGGGG - Intronic
1112751021 13:102583359-102583381 GAGGTGAGATGGAGGGTGTGAGG + Intergenic
1113052746 13:106232395-106232417 GATGTATAAAGGAGGGGCTGAGG - Intergenic
1113150481 13:107257777-107257799 GTGGTGGGAGGTAGGGGATGGGG + Intronic
1113884860 13:113653208-113653230 GAGGTGTGAAGCAGCAGGTGAGG - Intronic
1113898086 13:113778227-113778249 GAGATGTGAGGGAGGGAAAGGGG + Intronic
1113909820 13:113836571-113836593 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1113909832 13:113836593-113836615 GAGGGGTGAGGGAGGGGGTGGGG + Intronic
1113933264 13:113979823-113979845 GAGGTGTGCATGTGGGGAGGAGG - Intronic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114614033 14:24059015-24059037 GATGGGTGAATGATGGGATGAGG - Intronic
1115076426 14:29397820-29397842 GAGGTGGGAGGAAGTGGATGTGG - Intergenic
1115298836 14:31860967-31860989 GCTGTGTTAAGGAGGGGGTGAGG + Exonic
1115498301 14:34027479-34027501 GAGGGGGGAAGAAGGGGAGGGGG + Intronic
1115630167 14:35236990-35237012 AAGGAGTGAAGGAGGGAAGGAGG - Intronic
1115905766 14:38201504-38201526 GAGGTGACTAGGAGAGGATGTGG - Intergenic
1117517402 14:56515400-56515422 GCAGAGTGAAGCAGGGGATGGGG - Intronic
1117649063 14:57883028-57883050 GAGGGGAGAAGGAGGAGAAGGGG + Intronic
1117690332 14:58299172-58299194 GAGGGGAGGAGGAGGGGAGGTGG - Intronic
1118171940 14:63396197-63396219 GAGGAGAGGAGGAGGAGATGGGG + Intronic
1118448143 14:65870512-65870534 GGGTTGTGCAGGAGGGGCTGTGG - Intergenic
1118687175 14:68302584-68302606 GAGGTGTGAAGTAGGAAATCAGG + Intronic
1118883607 14:69849231-69849253 GAGGTGTCAGGCAGGGGAGGAGG + Intergenic
1118994346 14:70822729-70822751 GAGGAAGGAAGGAGGGGAGGAGG - Intergenic
1119149473 14:72345153-72345175 AAGGTGGGAAGGAGGGGGAGGGG - Intronic
1119193620 14:72701503-72701525 TAGGTTTGAAGGAGGGCAGGGGG - Intronic
1119768787 14:77207216-77207238 GAGGTGAGATGGATGGGGTGGGG + Intronic
1119862805 14:77948790-77948812 GGGGAGGGAAGGAGGGGGTGGGG - Intergenic
1120899917 14:89566891-89566913 GAGGGGAGAAGGAGGGGGTAGGG - Intronic
1121447436 14:93987936-93987958 GAGGTGGGAAGGAGGGAGTGGGG + Intergenic
1121485714 14:94312832-94312854 GAGCTGGGGAGGAGGGGAAGGGG + Intronic
1121515717 14:94548593-94548615 GAGGAGAGAGGGAGGGGATGGGG - Intergenic
1122122669 14:99562710-99562732 GAGGTGTGCAGGAGGGATGGAGG - Intronic
1122265476 14:100544749-100544771 GGGGTGTGTAAGAGGGGCTGTGG - Intronic
1122324806 14:100875694-100875716 GAGGTGGGAAGGAAGGGCAGGGG - Intergenic
1122359451 14:101150884-101150906 GAGGAGGGAAGGAAGGGAAGGGG - Intergenic
1122448113 14:101782824-101782846 GAGGAGAGAGGGAGGGGAAGGGG - Intronic
1122680383 14:103456412-103456434 GAAGTGTGAATGAGGGGAAGAGG - Intronic
1122734959 14:103833255-103833277 GAGGTAAGAGGAAGGGGATGAGG - Intronic
1122758070 14:103998061-103998083 AAGGTGTGGTGGAGGGGAGGAGG + Intronic
1122769997 14:104093653-104093675 GAGGTGTGTGGGTGGGGCTGTGG + Intronic
1122888590 14:104722593-104722615 GGGGTGTCAAGGAGGGAATTTGG - Intergenic
1123051364 14:105545701-105545723 TGGATGTGAAGGAAGGGATGTGG - Intergenic
1123114461 14:105888305-105888327 CAGGTGTGCAAGAGGGGATGTGG - Intergenic
1123117102 14:105899721-105899743 GGGGTGTGCAGGTGGGGGTGGGG + Intergenic
1123118672 14:105906961-105906983 CGGGTGTGTAAGAGGGGATGCGG - Intergenic
1123119177 14:105909030-105909052 GGGGTGTGCAGGTGGGGGTGGGG + Intergenic
1123120897 14:105916579-105916601 CGGGTGTGCAAGAGGGGATGCGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124418166 15:29491244-29491266 GAGGTGTGGAGGGAGGGGTGCGG - Intronic
1124439165 15:29674711-29674733 GCGGAGGGAAGGAGGGGGTGTGG + Intergenic
1124439170 15:29674725-29674747 GGGGTGTGGAGGAGGGAAGGAGG + Intergenic
1124877103 15:33605347-33605369 GAGGGATGAGGGAGAGGATGGGG - Intronic
1124964478 15:34423131-34423153 GAAGTGTGATGGAGGGGAGAGGG - Intronic
1124981097 15:34569357-34569379 GAAGTGTGATGGAGGGGAGAGGG - Intronic
1125066901 15:35498522-35498544 GAGGTGTGTGGGATGGGGTGAGG - Intronic
1125187654 15:36950171-36950193 GAGGTGTGAAAGGGGTGATTAGG - Intronic
1125460896 15:39905792-39905814 CAAGGGTGAAGGAGGGGATCGGG + Intronic
1125750547 15:42024642-42024664 GAGGTGGGAAGGAAGGGACAGGG - Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1125991553 15:44113690-44113712 GAAGTGGGGAGGAGGGGAAGCGG - Intronic
1126023868 15:44427521-44427543 GAGGTGGGAGGGAAGGAATGCGG - Exonic
1126883161 15:53120959-53120981 CTGGTGTAAAGAAGGGGATGTGG - Intergenic
1127058807 15:55161081-55161103 GTGAGGTGAGGGAGGGGATGGGG + Intergenic
1128185336 15:65639737-65639759 CAGGAGGGAAGGAGTGGATGGGG - Intronic
1128530449 15:68441558-68441580 GTGGTGTGGAGGAGGGGTGGAGG + Intergenic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1129254174 15:74324868-74324890 GAGGGGAGAAGGAGGAGGTGGGG - Intronic
1129334879 15:74845821-74845843 GAGGTCTGAAAGGGAGGATGTGG + Intronic
1129454026 15:75667013-75667035 GGGGTGTGAAGGGGTGGAAGAGG + Intergenic
1129675480 15:77630888-77630910 GAGGTGGGAGGGAGGGTATAGGG - Intronic
1129756867 15:78104012-78104034 GAGGCCTGAAGCAGAGGATGTGG - Exonic
1129992652 15:79978272-79978294 CAGGTGTGCCGGAGGGGATGAGG - Intergenic
1130051123 15:80484795-80484817 GAGGAGTGGTGGTGGGGATGGGG + Intronic
1130350107 15:83084080-83084102 GATGTGTGCAGGAGGGAATAGGG - Intergenic
1130720951 15:86385927-86385949 GAGGAGAGGAGGAGGGGAGGGGG - Intronic
1130910463 15:88267048-88267070 GAGCAGGGAGGGAGGGGATGAGG + Intergenic
1131720658 15:95165002-95165024 GAGGGCTGAAAGAGGGAATGGGG - Intergenic
1132433571 15:101779207-101779229 GAGGAGTGGAGTAGGGGAAGAGG + Intergenic
1132692867 16:1189334-1189356 GAGATGTGAGGAAGGGGAGGTGG + Intronic
1132803685 16:1766163-1766185 AACGTGGGAATGAGGGGATGGGG - Intronic
1132839833 16:1973629-1973651 GAGGAGTCAGGGAGGGGAAGAGG + Intronic
1133278777 16:4653289-4653311 GAGGTGTGGGGGAAGGGGTGGGG + Intronic
1133280840 16:4664346-4664368 GGGGGCTGGAGGAGGGGATGGGG + Intronic
1134047218 16:11109665-11109687 CACGTGTGAGGGAGGGGCTGTGG - Intronic
1134117738 16:11561802-11561824 GGGGTGATAAGGAGGGGATGGGG - Intronic
1134276612 16:12782038-12782060 GAGGTGTGAGGCTGGGGGTGGGG + Intronic
1134321977 16:13172064-13172086 GAGGAGGGAAGGAGGGAAAGGGG - Intronic
1134663042 16:15998472-15998494 GGGCTGTGATGGAGGTGATGTGG + Intronic
1134669739 16:16046051-16046073 CAGGGCTGCAGGAGGGGATGTGG - Intronic
1135042826 16:19131064-19131086 GAGCTTTGAAGGAGGGGTTGGGG - Intronic
1135404251 16:22186831-22186853 GAGGTAGGAAGGGAGGGATGGGG - Intronic
1135634166 16:24059952-24059974 GGGAATTGAAGGAGGGGATGTGG + Intronic
1136005342 16:27325243-27325265 GCGGGGTGAGGGAGGGAATGAGG - Intronic
1136171630 16:28493415-28493437 GAGGGGAGAAGGAGGGTATGGGG + Intronic
1136656591 16:31712907-31712929 GAGGTGCTAAGGATGGGATGAGG + Intergenic
1137505895 16:49053387-49053409 GATGTGTGAAGAAGGGGTGGGGG - Intergenic
1137874188 16:51980093-51980115 GAGGTGAGATGGATGCGATGGGG - Intergenic
1137937529 16:52648939-52648961 CATGTGTGAAGGAGGAGGTGGGG - Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138567164 16:57841894-57841916 GAGGGGAGGAGGTGGGGATGGGG - Intronic
1138972070 16:62157354-62157376 GAGGTGCGAAGGAAGGAAGGAGG - Intergenic
1139340892 16:66267260-66267282 AAGGTGTGTAGGAAGGTATGTGG - Intergenic
1139422865 16:66859661-66859683 GAGGTCTAAAGCAGGGGCTGAGG + Intronic
1139701387 16:68710110-68710132 GGGGCGGGAAGGAGGGGAAGTGG + Intronic
1139925342 16:70482934-70482956 GAGGAGAGAAGGAAGGGATGGGG - Intronic
1139925451 16:70483258-70483280 GAGGAGAGAAGGAAGGGATGGGG - Intronic
1139925467 16:70483306-70483328 GAGGAGAGAGGGAAGGGATGGGG - Intronic
1140584886 16:76277521-76277543 GAGGTGAGGAGGAAGGGAGGGGG + Intronic
1141276540 16:82593457-82593479 GTGATGTGAGGGATGGGATGGGG + Intergenic
1141343736 16:83226995-83227017 GAGGAGCGAAAGAGGGGATACGG + Intronic
1141526169 16:84613474-84613496 GATGTGTGAGGGAGGGTGTGTGG + Intronic
1141804654 16:86334714-86334736 GAGGAGGGAAGACGGGGATGGGG + Intergenic
1142443987 16:90122128-90122150 GAGGTGTGAGGGTGAGGATGAGG + Intergenic
1142762151 17:2049050-2049072 GGGGAGTGAAGGAGGGGGTGGGG + Intergenic
1142765221 17:2060644-2060666 GAGGGGTGAAGGGGGAGCTGAGG + Exonic
1142856155 17:2731480-2731502 GAGGTGTGAACCGGGGGTTGGGG + Intergenic
1143125967 17:4641098-4641120 GTGGTGAGAGGGAAGGGATGGGG - Intronic
1143173612 17:4944319-4944341 GAGGTGTGAGGGTGGAGATAGGG - Intronic
1143402515 17:6655725-6655747 GTGGTGAGAGGGAAGGGATGGGG + Intergenic
1143407513 17:6687235-6687257 AAGGGGTGAAGGTGGGGCTGAGG - Intronic
1143430704 17:6881097-6881119 GAGGTGTGAAGTAGGAAATCAGG + Intronic
1143491562 17:7288179-7288201 AAGGTGGGGAGGAGGGGATGTGG - Exonic
1143655390 17:8290798-8290820 CAGGCGGGAAGCAGGGGATGGGG - Intronic
1143683165 17:8492507-8492529 CAGCTGTGCAGAAGGGGATGGGG + Exonic
1144201174 17:12943895-12943917 GAGGACTGGAGGAGGGGGTGGGG - Intronic
1144212278 17:13025693-13025715 GAGGAGAGAGGGAGGGAATGAGG - Intergenic
1144670540 17:17130376-17130398 GAGGAGGGAGGGAGGGGAGGAGG - Intronic
1144779397 17:17800322-17800344 GGGCTGTGAAGCAGGGGAGGTGG - Intronic
1144951391 17:18996354-18996376 GAGGGGAGGAGGAGGGGAGGGGG - Intronic
1145904629 17:28509378-28509400 GAGGTGGGAGTGAGGAGATGAGG - Intronic
1146372713 17:32275421-32275443 GAGGTCGGAAGGAGGAGAAGGGG + Intronic
1146512270 17:33460289-33460311 AAGGTGCCAAGAAGGGGATGGGG + Intronic
1146519338 17:33514371-33514393 GGGGTGTGGAAGAGAGGATGGGG - Intronic
1146544222 17:33724518-33724540 CAGATGTGAAGGAGCGGAGGAGG + Intronic
1146648720 17:34592830-34592852 GAGGTGGGAATGTGGGGAGGTGG - Intronic
1146945692 17:36871953-36871975 GGGGTGGGAGGTAGGGGATGGGG - Intergenic
1147305269 17:39559496-39559518 CAAGGGTTAAGGAGGGGATGAGG - Intronic
1147364867 17:39953014-39953036 GCGGAGTGAAGGCGGGGCTGGGG + Intergenic
1147770815 17:42866765-42866787 GAGGAGGGAAGGAGGGAATCTGG + Intergenic
1147846442 17:43407242-43407264 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846446 17:43407250-43407272 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846450 17:43407258-43407280 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147886618 17:43688549-43688571 GAGGTGGGAAGAAGGAGCTGGGG + Intergenic
1148560668 17:48604173-48604195 GGGGTGCGAAAGAGAGGATGGGG - Intronic
1148794466 17:50190418-50190440 CAGGAGGGAAGGCGGGGATGCGG + Intronic
1148836827 17:50469812-50469834 GAGGGGTGCGGGAGGGGGTGGGG + Intronic
1148899959 17:50867607-50867629 GGGGAGCGAAGGAGGGGACGGGG + Intronic
1149140407 17:53426612-53426634 GAGGGGTGGAGGTGGGGGTGAGG - Intergenic
1149415986 17:56460528-56460550 GAGATGTGAAGGAGAGTGTGGGG - Intronic
1149591670 17:57834474-57834496 GGTGAGTGGAGGAGGGGATGGGG - Intergenic
1150364857 17:64573207-64573229 GAGGGGAGGAGGAGGGGAGGAGG + Intronic
1150469834 17:65427515-65427537 CAGGTTTAAGGGAGGGGATGTGG + Intergenic
1150765127 17:67996259-67996281 GGGGTGTGGAGAAGGGGTTGGGG - Intergenic
1151192551 17:72408942-72408964 GAGGTGTGGGGGAAGGGCTGTGG - Intergenic
1151311170 17:73293260-73293282 GAGGAATGAAGGAGGGGAGCTGG + Intronic
1151334148 17:73430226-73430248 GAGGAATGGAGGAGGGGGTGAGG - Intronic
1151654326 17:75488791-75488813 GAGGGGAGAAGGGGGGGAAGAGG - Exonic
1151835735 17:76581548-76581570 GAGCTGTAAAGGAGATGATGGGG + Intronic
1152421872 17:80198004-80198026 GATCTGTGAAGAAGGGGCTGAGG + Intronic
1152638504 17:81439896-81439918 GAGGTGGGGAGAAGGGGCTGAGG - Intronic
1152740960 17:82018142-82018164 GAGGTGGGCTGGAGGGGAAGTGG + Intergenic
1152751543 17:82064803-82064825 CAGGTGCGCAGGAGGGGCTGTGG - Exonic
1153492433 18:5663429-5663451 TAGGAGTGAAGGAGGAGTTGAGG - Intergenic
1155175537 18:23298261-23298283 GAGGTGAGAAGGCAGGGAGGCGG + Intronic
1155407008 18:25500132-25500154 GGGGTGGGATGGAGGGGGTGGGG + Intergenic
1155613893 18:27699903-27699925 GAGGTGAGAAGGAGTGATTGGGG - Intergenic
1156293836 18:35772852-35772874 CAGGGCTGAAGGAGAGGATGGGG - Intergenic
1156696658 18:39775696-39775718 GAGGTATGGAGGAGGATATGGGG + Intergenic
1157298414 18:46462329-46462351 AAGCTGTGAAGGAGGGAAAGGGG - Exonic
1157618316 18:49001058-49001080 GAGGTGGCAGGGAGGAGATGGGG + Intergenic
1157656333 18:49393045-49393067 GAGGAGGGGAGGAGGGGAGGAGG + Intronic
1157701039 18:49761710-49761732 GAGGTGTGTGTGTGGGGATGTGG - Intergenic
1157790004 18:50523305-50523327 GGGGAGGGAAGGAGGGGCTGAGG - Intergenic
1158254484 18:55530530-55530552 GGGCTCTGAAGGAGGGGAGGTGG + Intronic
1158305800 18:56103852-56103874 GAGGAGGGAAGGAGGGGAGGGGG + Intergenic
1158334572 18:56401949-56401971 GAGAAGGGAAGGAGGGGAAGTGG + Intergenic
1158830945 18:61277842-61277864 AAGGTGTGAGGGAGGGAGTGGGG + Intergenic
1159109771 18:64042975-64042997 GAGGTGTGGAGGGAGGGGTGCGG + Intergenic
1159607945 18:70494775-70494797 CAGGTGTCCAGCAGGGGATGGGG + Intergenic
1159904119 18:74075174-74075196 GAGGGCTGAGGGAGGGGATGAGG - Intronic
1160021558 18:75185458-75185480 GAGGTGGGAAGGAGGGCATTGGG - Intergenic
1160293517 18:77617019-77617041 GGGGTGTGCAGGAGGCCATGGGG + Intergenic
1160409554 18:78666670-78666692 GGGGTGTGCAGGAGAGGAAGGGG + Intergenic
1160718445 19:586992-587014 AAGGCCTGAAGGAGGGGGTGCGG - Intergenic
1160872226 19:1282608-1282630 GAGGAGGGAGGGAGGGGAGGAGG + Intergenic
1160872254 19:1282678-1282700 GAGGAGGGAGGGAGGGGAGGAGG + Intergenic
1160975417 19:1790278-1790300 GAGGGGAGAGGGAGGGGAGGGGG - Intronic
1161241745 19:3226826-3226848 GAGGGGTGAAGGAGGGGCTGGGG + Intronic
1161261764 19:3341683-3341705 GAGGGCTGCAGGAGGGGTTGGGG + Intergenic
1161399685 19:4061711-4061733 GAAGTGTGACAGCGGGGATGGGG + Intronic
1161409870 19:4111123-4111145 GGGGGCTGGAGGAGGGGATGGGG + Intronic
1161415725 19:4145431-4145453 GAGGTGGGGAGGAGGGGAAGAGG + Intergenic
1161451763 19:4350270-4350292 GAGGTGGGGAGGATGGGAAGGGG + Intronic
1161497984 19:4597914-4597936 GAGGGGTGAGGGAGGAGAAGGGG + Intergenic
1161498002 19:4597962-4597984 GAGGGGTGAGGGAGGAGAGGGGG + Intergenic
1161815686 19:6498535-6498557 GCAGAGTGAGGGAGGGGATGGGG - Intronic
1162158839 19:8697347-8697369 GAGGTGCCCAGGAGTGGATGGGG + Intergenic
1162367303 19:10257245-10257267 GAGAGGGAAAGGAGGGGATGAGG - Intronic
1162400648 19:10444581-10444603 GAGGCCTGAAGGAGGGAAAGAGG + Intronic
1162431435 19:10631248-10631270 GAGGGGAGAAGGAAGGGATTGGG - Intronic
1162652232 19:12098405-12098427 GAGGTGTGAAGGGGGAAATCAGG + Intronic
1162916442 19:13876915-13876937 GAGGTGTGTACGGGGGGCTGTGG + Intronic
1162917855 19:13883763-13883785 GAGGGGAGAAGCGGGGGATGAGG - Intronic
1162948784 19:14058538-14058560 GAGGTGTAGAGGTGGGGATCAGG + Intronic
1163272997 19:16265476-16265498 CTGGTGTGCAGGAGGAGATGGGG + Intergenic
1163608989 19:18291628-18291650 GAGGCGGGAGGAAGGGGATGCGG - Intergenic
1163618661 19:18344549-18344571 GAGGTCTGAAGTTGGGGATGAGG - Intronic
1163765791 19:19162630-19162652 GAGGTGGGAAGGAGGGTCTGAGG - Intronic
1164249732 19:23466294-23466316 GAGGAGAGGAGGAGGAGATGAGG - Intergenic
1164292445 19:23880379-23880401 GAGGAGAGAAGGAGAGGAGGAGG + Intergenic
1164463519 19:28468416-28468438 GAGGGGAGAAGGAGGGGAGAAGG + Intergenic
1164735923 19:30540878-30540900 GAGGGGTCAAGGAGGAGCTGGGG - Intronic
1164799262 19:31062477-31062499 GAGGTGGGATGGTGGGGAGGGGG + Intergenic
1164845924 19:31432540-31432562 GGGGTGTGAAGGAAGTGCTGTGG - Intergenic
1164918801 19:32073157-32073179 GTGGAGTGAAAGTGGGGATGGGG - Intergenic
1164934465 19:32200298-32200320 AAGGTGTCCAGGAAGGGATGGGG + Intergenic
1165420651 19:35720576-35720598 GAGGGGTGGAGGAGGTGAAGGGG - Exonic
1165434332 19:35788122-35788144 GGGGTGGGCAGGAGGGGAAGAGG - Exonic
1165554608 19:36619333-36619355 GGGTTGTGAAGGAAAGGATGTGG + Intronic
1165812490 19:38619964-38619986 GAGGTAGGCAGGAGAGGATGGGG + Intronic
1165900961 19:39169154-39169176 GAGAACTGAAGGAGGGGACGGGG + Intronic
1166007911 19:39919729-39919751 GAGGGGTCAAGGATGGGATAGGG + Intronic
1166356520 19:42230512-42230534 GAGGTCTGGGGGAGGGGAGGGGG + Exonic
1166361740 19:42255327-42255349 GAGGGAGGAAGGAGGGGGTGGGG + Intergenic
1166930433 19:46298457-46298479 AGGGGGTGCAGGAGGGGATGCGG - Intronic
1167339099 19:48904284-48904306 CAGGAGTGAGGGTGGGGATGGGG + Intronic
1167561286 19:50227436-50227458 GGGGGGTGCAGGCGGGGATGTGG - Intronic
1167765378 19:51479087-51479109 GAGAGGTGGGGGAGGGGATGGGG - Intronic
1167917646 19:52755138-52755160 GAGGTGTGAAGTAGGAAATCAGG + Intergenic
1168187521 19:54709490-54709512 GAGGGGAGAAGGAAGGGGTGTGG + Intergenic
1168336679 19:55600882-55600904 GGGGTGTAACGGAGGGGAAGGGG - Intronic
1168688335 19:58362060-58362082 GAGGTGAGGAGGAGGCGTTGAGG - Intronic
1168703937 19:58457522-58457544 AAGGTGAGATGGAGGGGGTGGGG - Exonic
1168718085 19:58540568-58540590 GAGGTGGGAAGCAGGGTGTGTGG - Intergenic
925019829 2:559544-559566 GAGATTTGAAGGAGGGGAAATGG + Intergenic
925347927 2:3183497-3183519 GAGGAGGGAAGGAAGGGGTGAGG - Intergenic
925420138 2:3704351-3704373 GGGGTGTGGAGGAGGGCGTGGGG + Intronic
925420227 2:3704549-3704571 CGGGTGTGGAGGAGGGCATGGGG + Intronic
925675561 2:6357821-6357843 GAGGGCTTAAGGAGGTGATGAGG + Intergenic
926047222 2:9718501-9718523 GAGGTCAGAGGGAGGGGAAGAGG + Intergenic
926240492 2:11081187-11081209 GAAGGGAGAAGGAGGGGAGGGGG - Intergenic
926341590 2:11908919-11908941 GACATGTGTGGGAGGGGATGTGG + Intergenic
926405793 2:12551483-12551505 TAGATGTGAAGGAAGGGCTGGGG - Intergenic
926694478 2:15761539-15761561 GAGGCGAGAAGCAGGAGATGAGG + Intergenic
926741095 2:16111538-16111560 GAAGTGTGAGGAAGGGGAGGAGG + Intergenic
926741208 2:16112109-16112131 GAAGTGTGAGGAAGGGGAGGAGG - Intergenic
927196229 2:20549144-20549166 GAGGCTGGAAGGAGGTGATGAGG - Intergenic
927315847 2:21681040-21681062 GAGGTGGGAGGGAGGGAAGGAGG + Intergenic
927542993 2:23928846-23928868 GAAGTGTCCAGGAGAGGATGTGG - Intronic
927599723 2:24430386-24430408 GAGGGGAGAAGGAGGCAATGAGG - Intergenic
927709194 2:25314573-25314595 GAGGTGTGGGGGTGGGGGTGAGG - Intronic
927985805 2:27409585-27409607 GAGCTGTGAGGGAGCGGAAGCGG + Exonic
929083430 2:38144798-38144820 CAGGTTTGGAGGAGGTGATGAGG - Intergenic
929150501 2:38743460-38743482 AAGGTGTGGAGGAGGGGTAGGGG - Intergenic
929458795 2:42085983-42086005 GAGGTGTGAAGGACGGCATGTGG + Intergenic
929781922 2:44962577-44962599 GGGGTAGGAAGGAGGGGCTGTGG - Intergenic
930148401 2:48031775-48031797 CAGGAGTTAAGGAAGGGATGGGG - Intergenic
930598398 2:53415186-53415208 GTAGTGGGGAGGAGGGGATGAGG + Intergenic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
931197248 2:60064340-60064362 GAGGGGTGGAGGAGGAGAGGAGG + Intergenic
931381494 2:61757708-61757730 CAGGGGTTAAGGAGGGGGTGGGG - Intergenic
931826248 2:66004023-66004045 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
933167900 2:79095492-79095514 GAGGTGGGAAGGACAGGAGGAGG + Intergenic
933206791 2:79515417-79515439 GAGTTGTGAATGTGGGGAGGTGG + Intronic
933263748 2:80158548-80158570 TAAGGGTTAAGGAGGGGATGAGG - Intronic
933287781 2:80402691-80402713 GAGGTCTGAACGAGGGGTTCAGG + Intronic
933971794 2:87475728-87475750 CATGTGTGAAGGTGGGCATGGGG + Intergenic
934618755 2:95791484-95791506 GTGGTGGGAAGGAGGGGCTGAGG + Intergenic
934642138 2:96033073-96033095 GTGGTGGGAAGGAGGGGCTGAGG - Intronic
935422773 2:102887028-102887050 GAGGGGGGAGGGAGGGGAGGGGG - Intergenic
935438056 2:103058140-103058162 GAGGTTTTAAGGAGTTGATGAGG + Intergenic
935535915 2:104294664-104294686 GAGGTGGGAAGGTAGGGGTGGGG - Intergenic
935550397 2:104446983-104447005 CAGCTGTAAAGGAGGGGAGGGGG + Intergenic
936321934 2:111474473-111474495 CACGTGTGAAGGTGGGCATGGGG - Intergenic
936484361 2:112913888-112913910 GAGGTGCGAGGGTGGGGATGGGG + Intronic
936667103 2:114609435-114609457 GAGGTGAGAAGCAGGGGGTGGGG + Intronic
937001960 2:118475775-118475797 GAGTTCTGAAGGAGGGGAAAGGG + Intergenic
937595268 2:123664597-123664619 GTGGAGTGAAGGAGGGGTAGTGG + Intergenic
937668809 2:124517260-124517282 GAGGTGTGGTGGTGGTGATGAGG + Intronic
937978649 2:127597421-127597443 CAGGTGTGAGGGAGGGGGCGTGG - Intronic
938097457 2:128473095-128473117 GAAGCGGGAAGGAGGGGAGGAGG - Intergenic
938119597 2:128624343-128624365 GGGGTGGGAAGGAGGGGAGCTGG - Intergenic
938262005 2:129903162-129903184 GGGGAGAGAATGAGGGGATGGGG - Intergenic
938654505 2:133417327-133417349 GGGGTGTGAAGGAGGCAATCGGG - Intronic
939400858 2:141692015-141692037 GATTTCTGAAGGAAGGGATGAGG - Intronic
939983229 2:148805673-148805695 GAGGGGTGGGGGAGGGGAGGGGG - Intergenic
940034232 2:149296367-149296389 GAGGGGTTAAAGAGGGGAAGGGG + Intergenic
940478736 2:154200727-154200749 GAGGTGTGTAAGAGGTGATCAGG - Intronic
941258069 2:163258898-163258920 GAGGTGTGAAGTAGGAAATTAGG + Intergenic
941387983 2:164876782-164876804 GAGGTAGGAAGGAGGCAATGGGG - Intergenic
941404684 2:165074294-165074316 CAGCTGTGTAGGAGGGGCTGGGG + Intergenic
941748986 2:169116061-169116083 GAGGGGAGAGGGAGGGGAAGTGG - Intergenic
942496036 2:176541061-176541083 GAGGAGGGGAGGAGGGGAGGGGG + Intergenic
942496054 2:176541097-176541119 GAGGGGAGGAGGAGGGGAGGAGG + Intergenic
942616082 2:177793441-177793463 GAGGTGGGCAAGAGTGGATGTGG + Intronic
942806643 2:179938711-179938733 GAGAGGGGAGGGAGGGGATGGGG + Intergenic
942926565 2:181440142-181440164 AAGGTGTAAAGGAGGGGAACAGG - Intergenic
944174003 2:196809348-196809370 GCTGAGTGAAAGAGGGGATGCGG + Exonic
946173040 2:217906557-217906579 GAGTTGTAAAGGAGAGGATTTGG - Intronic
946197094 2:218040179-218040201 CAGGTGTGAAGCTGGGGTTGAGG - Intronic
946213685 2:218167137-218167159 CAGGTGTGAAGCTGGGGTTGAGG + Intergenic
946324945 2:218980503-218980525 GAGGGATGAAGGTCGGGATGAGG + Intergenic
946373441 2:219294521-219294543 GAGGGATGAAGGAGGGGAGACGG + Intronic
946380608 2:219346238-219346260 GAGGGGGAAAGGAGGGGAGGGGG - Intergenic
946406483 2:219494690-219494712 GAATTTTGAAGGTGGGGATGAGG - Intronic
946705707 2:222456772-222456794 GAGTTGTGAAGCTGGGGCTGAGG - Intronic
946746553 2:222852318-222852340 GAGGTGTGAGGGAGAGGACAAGG + Intergenic
947177968 2:227386358-227386380 TAGGTGGGCAGGAGGGGATGAGG - Intergenic
947527305 2:230886532-230886554 GAGCTTTGAAGGTGGGGAAGAGG + Intergenic
947544949 2:231003901-231003923 GAGGTGTGAAGGTCTGGGTGGGG + Intronic
947699115 2:232217724-232217746 GAGGTATGGGGGAAGGGATGTGG + Intronic
947796583 2:232897075-232897097 GAGGGGTGAGGGTTGGGATGGGG + Intronic
948036203 2:234860093-234860115 GAGGAGAGAAGGAGGAGATGTGG + Intergenic
948111042 2:235456304-235456326 GGGGTCTGAATGAGGGAATGAGG - Intergenic
948133758 2:235620609-235620631 GAGGTGAGGAGGAGGGGCTGTGG - Intronic
948362384 2:237432229-237432251 CTGGTCTGAAGGAGAGGATGTGG + Intergenic
948511286 2:238466822-238466844 GAGGTGTGCTGGAGGGGGGGTGG + Intergenic
948523675 2:238557792-238557814 GGGATGTGAAGGAAGGAATGAGG + Intergenic
948699374 2:239750682-239750704 GAGGTGTCCAGGTGGGGAGGTGG - Intergenic
948856224 2:240731890-240731912 GAGGAGGGGAGGAGGGGAGGAGG + Intronic
948856228 2:240731898-240731920 GAGGAGGGGAGGAGGGGAGGAGG + Intronic
948856232 2:240731906-240731928 GAGGAGGGGAGGAGGGGAGGAGG + Intronic
948856269 2:240732010-240732032 GAGGAGGGAATGAGGGGAGGAGG + Intronic
948856275 2:240732026-240732048 GAGGAGGGAATGAGGGGAGGAGG + Intronic
948856301 2:240732094-240732116 GAGGAGAGAATGAGGGGAGGAGG + Intronic
948856313 2:240732122-240732144 GGGGAGGGGAGGAGGGGATGAGG + Intronic
948856366 2:240732292-240732314 GAGGAGAGAATGAGGGGAGGAGG + Intronic
948856447 2:240732565-240732587 GAGGGGGGTATGAGGGGATGAGG + Intronic
948889559 2:240900333-240900355 GCGGTGTGAGAGAGGGGAAGGGG + Intergenic
1170177673 20:13490665-13490687 GAGGGGTGAGGGAGGGAAGGAGG - Intronic
1170600674 20:17839079-17839101 GATGTGTGGAGGAAGGGGTGGGG - Intergenic
1170859195 20:20086977-20086999 GAGGTGGGAAGGAGGGAAGATGG + Intronic
1171346974 20:24472763-24472785 GAGGTGTGCAGAATGGGAGGGGG - Intronic
1171437297 20:25133509-25133531 GAGCTGGTTAGGAGGGGATGTGG - Intergenic
1172185655 20:33029590-33029612 GAGGTGGGAAGCACTGGATGGGG - Intergenic
1172630113 20:36372442-36372464 CAGATGTGAGGGAGGTGATGGGG - Intronic
1172776023 20:37407549-37407571 GAGATGTGAAGAGGTGGATGGGG - Intergenic
1172806815 20:37617953-37617975 GAGGTCTGCAGGAGGGGCTCTGG + Intergenic
1173065107 20:39703065-39703087 AAGGGGGGGAGGAGGGGATGGGG + Intergenic
1173096037 20:40029518-40029540 GAGGAGGGGAGGAGGGGAGGAGG + Intergenic
1173096041 20:40029526-40029548 GAGGAGGGGAGGAGGGGAGGAGG + Intergenic
1173149172 20:40551126-40551148 AAAGTCTGATGGAGGGGATGGGG - Intergenic
1173435738 20:43030745-43030767 GTGGTGTGGAGCAAGGGATGTGG + Intronic
1173458585 20:43223741-43223763 GCGGTTTGAAGTAAGGGATGGGG + Intergenic
1173851743 20:46222835-46222857 AAGGTGTGAGGGAAGGGAGGAGG - Intronic
1174290943 20:49508084-49508106 AAGGTGTGAAGGAGAGGAGTAGG + Intronic
1174298970 20:49568356-49568378 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1174582124 20:51579477-51579499 GAGGTGAGAAGCAGGAGGTGGGG - Intergenic
1175084198 20:56445228-56445250 GAGGAGCGAGGGAGGGGAGGAGG - Intronic
1175160347 20:57003558-57003580 GAGGTTTGGAGGAGGGGAGGAGG + Intergenic
1175384362 20:58584755-58584777 GAGGAGGGAAGGAAGGGAGGAGG - Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175811787 20:61862257-61862279 CAAGGGTGAAGGAGGAGATGGGG - Intronic
1175825880 20:61936379-61936401 GGGGTGTGGGGGAGGGGGTGTGG - Intronic
1175853260 20:62104916-62104938 GAGGTGGGAGGCAGGGGAGGTGG + Intergenic
1175906550 20:62382736-62382758 CAGGTGTGAAGGAGGGATTGAGG - Intergenic
1175988758 20:62777217-62777239 GAGGCAGGAAGGAGGAGATGAGG + Intergenic
1175988765 20:62777252-62777274 GAGGCAGGAAGGAGGAGATGAGG + Intergenic
1175988769 20:62777271-62777293 GAGGCAGGAAGGAGGAGATGAGG + Intergenic
1176131981 20:63500044-63500066 GGGTTGTGAGGAAGGGGATGTGG + Intergenic
1176381738 21:6117226-6117248 GAGACATGAAGAAGGGGATGCGG - Exonic
1176728673 21:10467435-10467457 GGGGGGTGGAGGCGGGGATGGGG - Intergenic
1177237319 21:18409814-18409836 GAGGGGTGAAGGGGGGAAGGGGG - Intronic
1177536623 21:22436589-22436611 GAAGTGTGAAGGAGTTGAGGAGG - Intergenic
1177840894 21:26232556-26232578 GAGACGTGGAGTAGGGGATGGGG + Intergenic
1177911489 21:27039123-27039145 GATGTGTGAAGGAGGGGTTTGGG + Intergenic
1178205034 21:30455127-30455149 TGGGGGTGAGGGAGGGGATGGGG - Intergenic
1178233353 21:30812936-30812958 GAGGACTGAAGGAGTGGATACGG + Exonic
1178578507 21:33816376-33816398 GATGTGTGTAGGTGGGGAGGGGG - Intronic
1178620071 21:34166557-34166579 GTGATGGGAAAGAGGGGATGGGG + Intergenic
1178626446 21:34222715-34222737 GAGGTCTGAGGGTGGGGGTGAGG + Intergenic
1178737572 21:35166807-35166829 GAGGTGTTCACGAGGGGCTGGGG - Intronic
1179084949 21:38207869-38207891 GAGGAGGGGAGGAGGGGAGGAGG - Intronic
1179135815 21:38678908-38678930 GAGGGGAGGGGGAGGGGATGGGG + Intergenic
1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG + Exonic
1179452213 21:41474620-41474642 GAGGGGTGAGTGAGGGGGTGAGG + Intronic
1179495583 21:41769426-41769448 GAGGTGGGAAGGAGGAGTTGGGG + Intergenic
1179520760 21:41942871-41942893 GGGCTGTGAAGTAGGGGTTGAGG - Intronic
1179690139 21:43075952-43075974 GTGGGGTGGAGGAGGGGCTGGGG - Intronic
1179722625 21:43324236-43324258 GAGGTCTTAGGGAGGGGCTGAGG - Intergenic
1179741734 21:43421013-43421035 GAGACATGAAGAAGGGGATGCGG + Exonic
1179962043 21:44773045-44773067 GAGGTAGGAGGGAGGGAATGGGG - Intronic
1180216321 21:46325315-46325337 GAGGCGGGCAGGAGGGGAAGGGG + Intronic
1180600544 22:17012548-17012570 GAGGAGAGCAGGAGGGCATGGGG + Intergenic
1180707206 22:17817251-17817273 GAGGGGTGCGGGAGGGGCTGGGG - Intronic
1180756476 22:18165484-18165506 GAGGGGTGAGGGATGGGAAGAGG - Intronic
1180865573 22:19117215-19117237 GAAGTGGGAAGGAAGGGGTGGGG + Intronic
1180872510 22:19154600-19154622 GAGGTGAGGGGGAGGGGAGGGGG - Intergenic
1181075293 22:20371950-20371972 GAGGGGTGAGGGATGGGAAGAGG + Intronic
1181278064 22:21699186-21699208 GAGGTGTGAAGCTGGGCAGGTGG + Exonic
1181381213 22:22506074-22506096 GGGATGTGAAGGAGAGGAGGAGG + Intronic
1182425153 22:30267762-30267784 GATGGGGGAAGGAGGAGATGGGG + Intergenic
1182556373 22:31131227-31131249 GAGGTGGGAAGGACAGGATGGGG - Intronic
1182663608 22:31942392-31942414 GAGGTGAGGAAGAGGAGATGAGG + Intronic
1182722155 22:32411921-32411943 GAGGGGAGAAGGACGGGATGAGG + Intronic
1182754848 22:32670859-32670881 GTGGTGAGTAGGAGGGCATGGGG + Intronic
1183057439 22:35315583-35315605 CAGGCCTGGAGGAGGGGATGAGG - Intronic
1183104620 22:35607163-35607185 GAGGTGGGCAGGAGGAGCTGAGG - Exonic
1183108359 22:35630350-35630372 GAGGGGAGGAGGAGGGGAGGAGG + Intronic
1183354542 22:37351151-37351173 GAGGGGAGAAGGAGGAGAGGAGG - Intergenic
1183508031 22:38220207-38220229 GAGGTGTGGAGGGGGAGAGGAGG + Exonic
1183614363 22:38934378-38934400 GTGGTGTGGGGCAGGGGATGGGG - Intergenic
1183717722 22:39543641-39543663 GAGTGGTGGAGGAGGGGAGGTGG + Intergenic
1183730838 22:39617592-39617614 CACGTGTGATGGAGGGGCTGCGG - Intronic
1183848452 22:40562699-40562721 GAAGAGGGAAGGAGGGGAAGGGG + Intronic
1183891042 22:40928985-40929007 GAGGTGGGAAGGTGGGTATGGGG - Exonic
1184015222 22:41780934-41780956 GTGATGTGAGAGAGGGGATGTGG + Intronic
1184321230 22:43743723-43743745 GAGGGGTGAAGGAGGGACTGGGG - Intronic
1185249012 22:49789841-49789863 GAGGTGTGGAGGAGGGGTTGTGG - Intronic
1185376570 22:50485359-50485381 AAGGTGTGAAGGAAGAGAGGAGG - Exonic
949572183 3:5304088-5304110 TAAGGCTGAAGGAGGGGATGGGG + Intergenic
949875780 3:8625203-8625225 GTGGAAGGAAGGAGGGGATGAGG + Intronic
950128478 3:10526164-10526186 GAGAGGAGAAGGAGAGGATGGGG - Intronic
950130583 3:10542929-10542951 GAGGTGAGAAAAAGAGGATGGGG - Intronic
950172691 3:10850576-10850598 GTGATGGGAAGGATGGGATGGGG + Intronic
950349252 3:12331383-12331405 GAGATGTGAAGGCTGTGATGTGG + Intronic
950465796 3:13153079-13153101 GAGGGGAGAAGGAGGGGAGAGGG - Intergenic
950774311 3:15336548-15336570 CAGCTGAGAATGAGGGGATGTGG + Intronic
951553435 3:23897552-23897574 GAGGTGTGTTGTAGGTGATGGGG - Intronic
951912403 3:27765234-27765256 GGGGTGGGGAGGAGAGGATGGGG - Intergenic
952802148 3:37304264-37304286 AAGGTGTTAAGGAGGGGACTGGG + Intronic
952881226 3:37987296-37987318 GAGGGGTGGAGGTGGGGATGGGG + Intergenic
953312185 3:41890840-41890862 AAGGGGGGAAGGAAGGGATGCGG + Intronic
953472312 3:43177667-43177689 TAGGTGTGCAGGAGGCAATGAGG - Intergenic
953797608 3:45997440-45997462 GAGGTGTGGAGGAAGGGGCGTGG + Intergenic
956330651 3:68103153-68103175 GAGGTGAGGATGAGGGGAAGTGG + Intronic
956440908 3:69279703-69279725 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956440919 3:69279734-69279756 GAGGGGAGGAGGAGGGGAAGAGG - Intronic
956440930 3:69279765-69279787 GAGGAGAGGAGGAGGGGAGGAGG - Intronic
956709939 3:72030246-72030268 GAGGTGTGAAGTGGGAAATGAGG + Intergenic
956839376 3:73123186-73123208 GGGGTAGGGAGGAGGGGATGGGG + Intergenic
957515154 3:81240696-81240718 AAGGAGGGAAGGAGGGAATGAGG + Intergenic
957552656 3:81727005-81727027 GATGGGTGGAGGAGGGTATGGGG + Intronic
960788408 3:121399444-121399466 GAGGTGTGAAGAAGGAAATCAGG + Intronic
961044844 3:123701105-123701127 GAGGGGAGCGGGAGGGGATGGGG + Intronic
961204304 3:125068629-125068651 GAGGGGTGAAGGGCAGGATGGGG + Intergenic
961205491 3:125078078-125078100 GAGGGGTAAAGCAGGGGAGGAGG - Intergenic
961265355 3:125637320-125637342 GAGGTGTGAAGTAGGAAATCAGG + Intergenic
961380204 3:126492083-126492105 GTGGTGGGAAGGAGGGCCTGGGG - Intronic
961679346 3:128588495-128588517 GAGGAGTGAAGAAGGGCCTGAGG + Intergenic
961706511 3:128790879-128790901 GAGGTGGGAAGGGGAGGCTGGGG - Intronic
962518998 3:136180743-136180765 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
962816713 3:139006641-139006663 GAGGTGCGGAGGTGGGGAGGTGG + Intronic
962816717 3:139006649-139006671 GAGGTGGGGAGGTGGGGAGGTGG + Intronic
962865923 3:139448014-139448036 GAGGTGAAGAGGAAGGGATGAGG - Intergenic
963344487 3:144078376-144078398 CAGGTGTGAAGTAGGGCACGTGG + Intergenic
963941213 3:151097954-151097976 AGGGTGTGTAGGAGTGGATGGGG + Intronic
965772227 3:172193225-172193247 GAGGAGGGGAGGAGGGGAGGAGG - Intronic
965772231 3:172193233-172193255 GAGGAGGGGAGGAGGGGAGGAGG - Intronic
966461394 3:180180601-180180623 GAGGGGGGAAGGAGGGAGTGAGG + Intergenic
966630735 3:182071477-182071499 GAGGTGTGGGGGAAGGGGTGTGG + Intergenic
966642206 3:182203901-182203923 GAGGTGAGATGGAGAGGAAGTGG - Intergenic
966811990 3:183855143-183855165 AAGGAGGGAAGGAGGGAATGGGG + Intronic
966904785 3:184514127-184514149 GAGGAGTGAAGGACGGGGAGGGG - Intronic
967013377 3:185459865-185459887 GTGGTGGGGAGGAGGGAATGGGG - Intronic
967451173 3:189625010-189625032 GAGTTGTGATGGAGTGGCTGTGG - Intergenic
967470899 3:189860987-189861009 GAGGAAGGTAGGAGGGGATGCGG - Intronic
967726735 3:192869299-192869321 GAGGAGGGAAGGAGGGAAGGAGG + Intronic
967870987 3:194228958-194228980 GGGGAGGGAAAGAGGGGATGGGG - Intergenic
968278755 3:197459777-197459799 GATGTGGTCAGGAGGGGATGCGG + Intergenic
968521526 4:1036687-1036709 GGGGTGTGAAGGAAGGGGTGAGG - Intergenic
968593972 4:1473054-1473076 GGGGTGGGCAGGTGGGGATGTGG - Intergenic
968948091 4:3676040-3676062 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948095 4:3676048-3676070 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948099 4:3676056-3676078 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968960516 4:3740920-3740942 GAGGGATGAAGCAGGGGAGGAGG + Intergenic
969371491 4:6734121-6734143 AAGGACGGAAGGAGGGGATGAGG + Intergenic
969424353 4:7115580-7115602 GAGGTGAGGAGGAGGTGAGGTGG + Intergenic
969424359 4:7115602-7115624 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424362 4:7115613-7115635 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424364 4:7115624-7115646 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424370 4:7115646-7115668 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424373 4:7115657-7115679 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424375 4:7115668-7115690 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424381 4:7115690-7115712 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424384 4:7115701-7115723 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424386 4:7115712-7115734 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424392 4:7115734-7115756 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424432 4:7115953-7115975 GAGGTGATGTGGAGGGGATGAGG + Intergenic
969427113 4:7130965-7130987 GTGGTGTGAAGGTGTGAATGTGG + Intergenic
969684596 4:8664096-8664118 GAGGTGGGGAGGAGAGGAGGGGG + Intergenic
969834651 4:9830848-9830870 GAGGTGAGCATGAAGGGATGTGG + Intronic
970099656 4:12505608-12505630 AAAGAGTGAAGGAGGGGCTGGGG - Intergenic
970234037 4:13940399-13940421 GAGGTATGGGGGAAGGGATGTGG + Intergenic
970310259 4:14775600-14775622 GAGGTTTGAAGTTTGGGATGGGG - Intergenic
970506546 4:16736091-16736113 GAGGTGGGAAGGAGTGTAGGAGG - Intronic
970982831 4:22122301-22122323 GGAGTGTGTGGGAGGGGATGTGG - Intergenic
971120214 4:23696248-23696270 GTGGTGGGAAGTATGGGATGGGG - Intergenic
971177393 4:24293349-24293371 GAGGAGTGCAGGAAGGGGTGGGG - Intergenic
971385312 4:26136412-26136434 GAGATGTGGAGGCTGGGATGAGG - Intergenic
971873396 4:32273551-32273573 GAGGTGTGAAGTGGGAGATCAGG + Intergenic
971950203 4:33334562-33334584 GAAGTGTGGAGGAGTGGGTGTGG - Intergenic
972216563 4:36904526-36904548 TTGGTGTGGAGGAGGGGAGGTGG + Intergenic
972387564 4:38582504-38582526 GAGGTGAGAAGGTGGGAATTGGG - Intergenic
972418017 4:38861726-38861748 GAGGTGTGAAAGAGGAGAACAGG - Intergenic
972547773 4:40096860-40096882 CAGGTTTGAAGGGGGTGATGAGG + Intronic
972587199 4:40448911-40448933 TTGGGGTGAAGGAGGGGGTGGGG + Intronic
972619573 4:40733822-40733844 AAGGTGGGAAGGAGGGAAGGAGG + Intergenic
972876850 4:43372890-43372912 GTCGTGTGGAGGGGGGGATGGGG - Intergenic
973274577 4:48293389-48293411 GAGGTGTGAAGTGGGAAATGAGG + Intergenic
973531287 4:51839116-51839138 AAGGAGAGAAGGAGGGAATGAGG + Intergenic
973807628 4:54540918-54540940 GAGGTGTGAAGGGGAGGGTCAGG - Intergenic
973879205 4:55251711-55251733 TAGCTGTGAAGCAAGGGATGTGG + Intergenic
974362410 4:60899349-60899371 GAGGTTTGAAGGAGGGCGGGAGG - Intergenic
974433747 4:61831464-61831486 CAGGAGTGAAGCAGGGGAGGTGG + Intronic
974849273 4:67385621-67385643 GAGGGGGGAAGGAGGGGGAGGGG + Intergenic
975491080 4:74989473-74989495 AAGGTATGTAGGAAGGGATGTGG + Intronic
975491337 4:74992083-74992105 AAGGTGTGTAGGAAGGGATGTGG + Intronic
975528624 4:75377856-75377878 AAGGGGAGAAGGATGGGATGTGG - Intergenic
976587278 4:86812734-86812756 GAAGAGTGAAGGAGGAGGTGAGG + Intronic
976753370 4:88473301-88473323 GAGGGAGGAAGGAGGGGAGGAGG - Intronic
978728627 4:111999336-111999358 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
979267200 4:118717443-118717465 GAGGTGGGAGGGAGGGAGTGGGG - Intergenic
979367252 4:119840313-119840335 GGGGTGGGAGGGCGGGGATGGGG - Intergenic
980213306 4:129817734-129817756 GAGGAGTTAAGGAGGAGCTGAGG - Intergenic
980328420 4:131379357-131379379 GAGGTGTGGAGGAGGAGGCGCGG + Intergenic
980599813 4:135007635-135007657 GAGGTGGGCAGGAAGGGCTGGGG - Intergenic
981212782 4:142128779-142128801 GATGTGTGGAGGAGGTGAGGGGG - Intronic
982510327 4:156274729-156274751 GGGGTGGGATGGAGGGGATGGGG + Intergenic
982700683 4:158657480-158657502 GAGGTGTGGAGGGAGAGATGCGG + Intergenic
983263473 4:165482810-165482832 GTGGTGTCAGGGAGGGGAAGTGG + Intronic
983595130 4:169457700-169457722 GAGGGGAGAAGGAGGGGAGAGGG + Intronic
984212183 4:176863452-176863474 AAAGTGTGAAGGGTGGGATGAGG + Intergenic
984261495 4:177448494-177448516 TAGGAGGGAAGGAGGGGGTGAGG - Intergenic
984478669 4:180270443-180270465 CAGGAATTAAGGAGGGGATGAGG + Intergenic
984658963 4:182352089-182352111 GAGGAGTGGGGGAGGGGAGGAGG - Intronic
984762752 4:183376810-183376832 GAGGTGGGGAGTGGGGGATGGGG - Intergenic
984869153 4:184311453-184311475 GTGGTGGGAAGGAAGGGGTGGGG - Intergenic
985209825 4:187580871-187580893 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
985496189 5:207772-207794 GAGGTGTGGAGGGGTGGAGGTGG + Intronic
985996878 5:3602065-3602087 GAGGTGTGAACGAGGGGCTGAGG + Intergenic
986451791 5:7872805-7872827 GAGGTGTTAAAATGGGGATGGGG - Intronic
986587052 5:9329354-9329376 GATGTGTGAATGAGTGGGTGTGG + Intronic
986935641 5:12882550-12882572 GAGGTGTGGAGTATGGGGTGTGG - Intergenic
988718611 5:33853611-33853633 GATGGGTGAAGGAGTGGAAGAGG - Intronic
989189969 5:38661117-38661139 GAGGGGTGGAGCAGGGGGTGGGG + Intergenic
990004599 5:50931386-50931408 GAAGTTTGAAGGTGGGGATGGGG + Intergenic
990090245 5:52036581-52036603 ATGGTGTGAGGGAGGGGCTGAGG - Intronic
990114683 5:52374452-52374474 GAGGAGTGAAAGGGTGGATGAGG - Intergenic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
990589739 5:57249950-57249972 GAAGGGGGAAGGAGGGGAGGGGG - Intronic
990676866 5:58196500-58196522 GACATGTGGAGGAGGTGATGGGG + Intergenic
990999626 5:61769690-61769712 GAGGTAAGAAAGAGGGAATGAGG - Intergenic
991094873 5:62729170-62729192 GAGGAGTGAATGAGAGTATGGGG + Intergenic
991345219 5:65658649-65658671 GAGGAGTGGAAGAGGGTATGTGG - Intronic
991372704 5:65936149-65936171 GAGGTCTGATGGAGGGGGGGTGG + Intronic
991452579 5:66768620-66768642 CAGGGATTAAGGAGGGGATGAGG + Intronic
991469772 5:66955416-66955438 GAGCTGTAGAAGAGGGGATGTGG + Intronic
991932332 5:71765966-71765988 GCGGTGAGAAGGAGGTGGTGTGG + Intergenic
992615469 5:78542589-78542611 GAGGTGTGCATGTGGAGATGAGG - Intronic
993680852 5:90875582-90875604 AAGGTGAGATGGAGGGGAAGAGG + Intronic
994105687 5:95945989-95946011 GAGGGGTTAGGGAGGGGATTAGG - Intronic
994309129 5:98246113-98246135 GAAGTGTGAAGGAGTAGAAGTGG - Intergenic
994456226 5:100011397-100011419 AAGGTGTAAAGTAGGGGTTGAGG - Intergenic
994674521 5:102804027-102804049 GAGGGTTGCAGGGGGGGATGGGG + Intronic
995123785 5:108560124-108560146 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
995301013 5:110582507-110582529 GAGGTGGAAACGAGGGGAAGAGG + Intronic
995508445 5:112884268-112884290 GAGGGGTGCAGGAGGAGATGAGG - Intronic
995553653 5:113305089-113305111 GAGGGGTGAAGGAAGGTCTGAGG + Intronic
995996325 5:118304830-118304852 AAGGAGGGAAGGAGGGGAAGAGG + Intergenic
996707670 5:126513531-126513553 GAGGTATGGGGGAGGGGGTGTGG - Intergenic
997425640 5:133800935-133800957 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
997444884 5:133933712-133933734 GAGGAATGAAGGAAGGGGTGAGG - Intergenic
997703003 5:135917943-135917965 GAGGAGAGGAGGAGGGGAGGAGG + Intergenic
997860753 5:137413551-137413573 GAGCTGTGAAGGAATAGATGTGG - Intronic
998136258 5:139676193-139676215 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
998136299 5:139676305-139676327 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
999277274 5:150339551-150339573 GAGGAGTGAGTGAGGGGCTGAGG - Intergenic
999500090 5:152138203-152138225 GAGGTCTGATGGAGTGGAAGGGG - Intergenic
999501296 5:152149115-152149137 GTGGTGGGAAGAAGGGGAAGAGG - Intergenic
1000173271 5:158725282-158725304 ATGGTGGGAAGGAGGGGTTGTGG - Intronic
1001000776 5:168004941-168004963 GAGATGGGGATGAGGGGATGGGG - Intronic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001284529 5:170412876-170412898 GTGGTGTAAATGAGGGGGTGGGG - Intronic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1001421647 5:171592179-171592201 GATTTGTGAAGGAAGGCATGAGG + Intergenic
1001453965 5:171846747-171846769 GAGGTGGGATGCGGGGGATGGGG - Intergenic
1001518299 5:172372799-172372821 GAGGTTTGAAGGGGTTGATGAGG - Intronic
1001582678 5:172809600-172809622 GAGGTATAAGGGAAGGGATGCGG - Intergenic
1001609850 5:172991596-172991618 GAGGTGAGAAGGATGGGTGGAGG + Intronic
1001893221 5:175356607-175356629 GGGGTGTGGAGGAGGGGAGCTGG - Intergenic
1001913112 5:175537277-175537299 GAGGTGTGAAGGAGGGCAGAGGG - Intergenic
1002102379 5:176863835-176863857 GAGGAGTGGGGGAGGGGAGGAGG - Intronic
1002200645 5:177525924-177525946 GAGGTGGGATGGAGAGGTTGGGG - Intronic
1002298322 5:178243605-178243627 GAGGTGTGAAATAGGGGTGGTGG + Intronic
1002363520 5:178692765-178692787 CAGGAGTTAAGGAGGGGCTGAGG + Intergenic
1002635561 5:180606365-180606387 CAGGGGTGACGGAGGAGATGGGG - Intronic
1002690480 5:181046334-181046356 GAAGTGTGCAGGAGGTGTTGGGG - Intronic
1002726113 5:181297607-181297629 GAGGAGGGAAGGAGGGGAAAAGG - Intergenic
1002791426 6:440652-440674 GAGATGGAAAGGATGGGATGGGG - Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003251499 6:4432612-4432634 GAGGTGAGCATGAGAGGATGTGG - Intergenic
1003252635 6:4444330-4444352 TAAGGGTGAAGGAGGGGATAAGG - Intergenic
1003483902 6:6557957-6557979 GACGTGGGAGGGAGGGGTTGTGG - Intergenic
1003836252 6:10075048-10075070 GAGGTGTGGAGGAAGAGGTGCGG - Intronic
1003879284 6:10465694-10465716 GAGGTCTGAATGAGGGGAGGAGG + Intergenic
1004053818 6:12114175-12114197 AAGGAGTGAAGGAGGGCATGAGG - Intronic
1004217544 6:13716741-13716763 GAGGCGTGAAGGAAGAGCTGCGG + Intergenic
1005231686 6:23709189-23709211 GCTATGTGAAGGAGGGAATGGGG + Intergenic
1005266812 6:24120772-24120794 CAGGGGTGAAGGTGGGGATGGGG - Intergenic
1005620682 6:27617380-27617402 GGGGGATGAAGGTGGGGATGCGG + Intergenic
1006070964 6:31497814-31497836 GGGGTGGGAATGCGGGGATGGGG + Intronic
1006116703 6:31779539-31779561 GTGGGGTGGAGGAGGGGGTGAGG + Intronic
1006164598 6:32057013-32057035 GAGCTGTGCTGGAGGGGCTGTGG - Intronic
1006336672 6:33424694-33424716 GAGGTGTTAAGGAGAGGATATGG + Intronic
1006372852 6:33656193-33656215 TTGCTGTGAAGGAGGGGATGTGG + Intronic
1006591417 6:35160728-35160750 GAGGTGGAAAGGAAGGCATGGGG + Intergenic
1007091964 6:39190299-39190321 GAGGTGGGAGTGAGGAGATGAGG - Exonic
1007231014 6:40347850-40347872 GAGGAGGGGAGGAGGGGAGGAGG - Intergenic
1007380699 6:41488512-41488534 GAAGTGTGTAGGAGGGGCTGGGG - Intergenic
1007400024 6:41598146-41598168 AAGGTGGGAAGGTGGGGAGGTGG - Intronic
1007741036 6:44009612-44009634 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1007983648 6:46185483-46185505 GATGAGTGAATGAGGGAATGTGG + Intergenic
1008013450 6:46491654-46491676 GAAGTGGAAAGGAGGGGGTGCGG - Intronic
1008627869 6:53335487-53335509 GTGGGGTGGGGGAGGGGATGAGG - Intronic
1008830183 6:55749751-55749773 GATGTGTGTGGGGGGGGATGTGG + Intergenic
1009411331 6:63368501-63368523 GAGGCTTGAAGGAGGGGAAGTGG - Intergenic
1010146332 6:72673607-72673629 GAGGAGTGGAGGAGGCGAAGAGG + Intronic
1010192697 6:73209918-73209940 CAAGGATGAAGGAGGGGATGTGG + Exonic
1010970025 6:82253324-82253346 GAGGTATGAGGGAAGGGACGTGG - Intergenic
1011217411 6:85019605-85019627 GGGGGATGAAGGATGGGATGTGG - Intergenic
1011410279 6:87059831-87059853 GAGGCGGGGAGGAGGGGAGGCGG + Intergenic
1011410287 6:87059847-87059869 GAGGCGGGGAGGAGGGGAGGAGG + Intergenic
1011417423 6:87137279-87137301 GAAGGGGGAAGGAGGGGACGAGG - Intergenic
1011417429 6:87137295-87137317 GAGGAGGGGAGGAGGGGAAGGGG - Intergenic
1011499947 6:87976972-87976994 GAGGTGAGGAGGAGGTGAGGTGG - Intergenic
1011598262 6:89037041-89037063 TGGGGGTGCAGGAGGGGATGAGG - Intergenic
1011654194 6:89534924-89534946 CAGGTGGGAGGGTGGGGATGAGG - Intronic
1011749220 6:90438614-90438636 GAGGTGTTGGAGAGGGGATGAGG + Intergenic
1011817980 6:91214576-91214598 GAGATGTGAAGAATGAGATGAGG + Intergenic
1011913491 6:92472014-92472036 GAGGTGGGAAGAAGGGGGTTTGG + Intergenic
1012518506 6:100092237-100092259 GTAGAGTAAAGGAGGGGATGGGG + Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1013619142 6:111872422-111872444 GAAGAGTGAAGGGGAGGATGGGG + Intronic
1013681544 6:112529699-112529721 AAGGAGTAAAGGAGGGGATGAGG - Intergenic
1013768036 6:113596252-113596274 GAGATTTGAGGGAGGGGCTGAGG + Intergenic
1014046701 6:116897158-116897180 GAGGAGTGGAGTAGGGGAAGAGG + Intronic
1014062617 6:117090567-117090589 CAGGTGTTAAGGAGGGGTTGGGG + Intergenic
1014154927 6:118099471-118099493 GAGGAGGGGAGGAGGGGAGGAGG - Intronic
1014980545 6:127941302-127941324 AAGGTGTGAGCGAGGGGAGGTGG - Intergenic
1015256487 6:131184223-131184245 GACTTGTGAAGGAGAGGAGGAGG + Intronic
1015988587 6:138911784-138911806 GATGTGTGAGGGAGAGGAGGAGG + Intronic
1016047951 6:139499697-139499719 GAGGTGGGAGGTGGGGGATGGGG - Intergenic
1017123834 6:151048380-151048402 GAGGTGGGAAGTGGGGGAGGTGG - Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017637414 6:156456298-156456320 GGGATGGGGAGGAGGGGATGGGG - Intergenic
1018473248 6:164114780-164114802 GAGGTGGGAGGATGGGGATGGGG + Intergenic
1018647402 6:165961106-165961128 GTGGTGGGAGGGTGGGGATGGGG + Intronic
1018847199 6:167563818-167563840 AATGTGTGAATGAGGGAATGAGG - Intergenic
1019017137 6:168888129-168888151 GAGGTGTGACGATGGGGAAGGGG + Intergenic
1019021987 6:168927135-168927157 GAGGTCTGACCGAGAGGATGAGG - Intergenic
1019059015 6:169242596-169242618 GCGGTGGGAAGGTGGGAATGTGG - Intronic
1019059154 6:169243009-169243031 AAGGTGGGAAGGTGGGAATGTGG - Intronic
1019173219 6:170146446-170146468 GAGGTGTGTAGGAGGGTGAGAGG + Intergenic
1019223486 6:170493207-170493229 GAGGTGAGGAGGAGGGGGGGAGG + Intergenic
1019223553 6:170493380-170493402 GAGGGGAGGAGGAGGGGAGGAGG + Intergenic
1019223556 6:170493388-170493410 GAGGAGGGGAGGAGGGGAAGAGG + Intergenic
1019223571 6:170493434-170493456 GAGGAGGGCAGGAGGGGAAGAGG + Intergenic
1019223597 6:170493521-170493543 GAGGTGAGGAGGAGAGGAGGAGG + Intergenic
1019335165 7:479226-479248 GAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1019624382 7:2008655-2008677 GGGCTGTGGAGGAGGGGCTGAGG - Intronic
1019697319 7:2452746-2452768 GAGGGGAGAGGGAGGGGATGGGG - Intergenic
1019797300 7:3060331-3060353 GAGGGGTGACGGAGGAGATTTGG - Intergenic
1020283515 7:6663719-6663741 GAGGGGAGCAGGAGGGGATGTGG + Intergenic
1021080755 7:16361677-16361699 GAGCTGGGAGGGAGGGGAAGAGG + Intronic
1021149618 7:17133591-17133613 AAGGTGGGAAGGAGGAAATGGGG + Intergenic
1021614258 7:22486672-22486694 AAGGTGGGCAGGAAGGGATGTGG - Intronic
1022050483 7:26663758-26663780 GAGGTGGGAAGGATGGGAAAAGG + Intergenic
1022104170 7:27186330-27186352 GAGGTGGAAAGGACGGGCTGAGG + Intergenic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1022636164 7:32137790-32137812 GAGGGAAGGAGGAGGGGATGGGG - Intronic
1023400190 7:39787040-39787062 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1023417841 7:39949679-39949701 GAGGCGAGAAGGAGGGGTTGTGG + Intergenic
1023722902 7:43113499-43113521 GACGGGTGCAGGAGGGGAGGAGG + Intronic
1023836768 7:44073183-44073205 GAGGGGTGAAGGTGGGGGTCAGG + Exonic
1024013945 7:45294309-45294331 GGGGTGTGAAGGGGCTGATGGGG + Intergenic
1024073118 7:45802791-45802813 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1024110996 7:46146122-46146144 GAGGTGGGGAGGAGGGGAGAGGG - Intergenic
1024423190 7:49193904-49193926 GAGGTGGGAAGGACGGAATCAGG - Intergenic
1024470600 7:49765851-49765873 GAGGGGTGAGGGAGTGGAGGGGG + Intergenic
1024650213 7:51397397-51397419 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1025054360 7:55753046-55753068 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1025117193 7:56268428-56268450 GAGGTGGGAAGGAGGAAAGGAGG - Intergenic
1025117198 7:56268444-56268466 GAGGAAGGAAGGAGGGGAGGTGG - Intergenic
1025117212 7:56268476-56268498 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025117217 7:56268492-56268514 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025117238 7:56268556-56268578 GAGGAAGGAAGGAGGGGAAGAGG - Intergenic
1025132410 7:56383199-56383221 GAGGGGAGAAGTAGGGGAGGAGG - Intergenic
1025183470 7:56837653-56837675 GAGGAGAGAAGTAGGGGAGGAGG - Intergenic
1025688455 7:63739314-63739336 GAGGAGAGAAGTAGGGGAGGAGG + Intergenic
1025945130 7:66099331-66099353 GAGGGGAGGAGGAGGGGAGGAGG + Intronic
1025945135 7:66099342-66099364 GAGGGGAGGAGGAGGGGAGGAGG + Intronic
1025945150 7:66099389-66099411 GAGAGGAGAAGGAGGGGAGGAGG + Intronic
1025978081 7:66385467-66385489 GAGGAGAGAAGTAGGGGAGGAGG - Intronic
1026005141 7:66594438-66594460 GAGGTGTGAAGGGGGAAATCAGG - Intergenic
1026104163 7:67407888-67407910 GAAGTGGGAGGGAGGGGAGGAGG - Intergenic
1026261827 7:68762037-68762059 GAGGTGATAAGGAGGAGCTGGGG + Intergenic
1026285017 7:68955268-68955290 GAGGGGAGAGGGAGGGGAGGGGG + Intergenic
1026975563 7:74495640-74495662 GAGGAGGGAAGGAGGGGCTGAGG + Intronic
1027025790 7:74851164-74851186 GAGGTGTGAGGGTGGGGGCGGGG - Intronic
1027061971 7:75092955-75092977 GAGGTGTGAGGGTGGGGGCGGGG + Intronic
1027151182 7:75734812-75734834 GCTGGGTGGAGGAGGGGATGGGG - Intronic
1027626977 7:80558118-80558140 GAAGTGTGAAGGGTGGGAGGAGG - Intronic
1028414045 7:90560884-90560906 GTTGTGGGAAGGAGGGAATGGGG + Intronic
1028427596 7:90707441-90707463 GAGAGGTGAAGGAAGGGAAGTGG - Intronic
1028636755 7:92997877-92997899 AAGGAGTGAAGGAGGGAAGGAGG - Intergenic
1028987152 7:97017573-97017595 GAGCTCTGAAGGTGGGGGTGAGG + Intergenic
1029205530 7:98867465-98867487 GGGGTGGCAGGGAGGGGATGGGG - Intronic
1029221854 7:98996125-98996147 TAGGTGTGTATGATGGGATGAGG - Intronic
1030036767 7:105414566-105414588 GAAGTCTGAAGCAGGGAATGAGG - Intergenic
1030406805 7:109125270-109125292 TAGGGGAGAAGGAGGGGAGGAGG + Intergenic
1030656510 7:112174014-112174036 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1030656514 7:112174022-112174044 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1031484728 7:122312760-122312782 AATGTGGGAAGGAGGGGTTGGGG - Intergenic
1031513353 7:122674200-122674222 GAGGTGTGAAGGGAGAGGTGCGG - Intronic
1031833647 7:126656264-126656286 GAAATGTGAAGGAGGGGCTTAGG + Intronic
1031993020 7:128210154-128210176 AAGGAGAGAAGGAGGGGAGGTGG + Intergenic
1032050505 7:128646485-128646507 GAGGGGAGAAGTAGGGGAGGAGG + Intergenic
1032279990 7:130492348-130492370 GCGGTGGGAACGAGGGGGTGTGG + Intronic
1032883946 7:136117474-136117496 GAGGTGTGTAAGAGGGCTTGTGG - Intergenic
1033385378 7:140869275-140869297 AAGATGTTAAGAAGGGGATGGGG - Intronic
1033529410 7:142247401-142247423 GAGGTGGGCAGGAAGGGAGGGGG - Intergenic
1034271321 7:149804600-149804622 GAGGAGTGGGGGAGGGGAGGGGG + Intergenic
1034343823 7:150373683-150373705 AAGGAGCGAAGGAGGGGCTGCGG - Intronic
1034437787 7:151071341-151071363 GAGGTGGGCAAGAGGGGCTGGGG + Intronic
1034497910 7:151433115-151433137 GTGGTGTGCAGAAGGGGAGGAGG - Intronic
1034552804 7:151832221-151832243 GAGGAGGGAAGGAGAGGAGGAGG + Intronic
1034552810 7:151832237-151832259 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034552816 7:151832253-151832275 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034552822 7:151832269-151832291 GAGGAGGGAAGGAAGGGAGGAGG + Intronic
1034988667 7:155533898-155533920 GTGGGGAGGAGGAGGGGATGTGG - Intergenic
1035103469 7:156420689-156420711 GAGGTTTGAAGGGGGAGGTGGGG + Intergenic
1035221012 7:157406571-157406593 GAGCTGTGCAGGAGAGGATGGGG + Intronic
1035230549 7:157463525-157463547 GAGGGGTGAGGATGGGGATGGGG - Intergenic
1035299992 7:157890989-157891011 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1035368186 7:158361891-158361913 GAGCTGGGAAGAGGGGGATGAGG - Intronic
1035583109 8:752559-752581 GGAGTCAGAAGGAGGGGATGGGG + Intergenic
1035663973 8:1366552-1366574 GAGGTGTGAGGGGAGGGATGGGG + Intergenic
1035726706 8:1829270-1829292 GAGCTGTGACGGAGGGAATGCGG + Intronic
1035909374 8:3548887-3548909 CAGGTGAGAAGGGGAGGATGTGG - Intronic
1036165606 8:6429847-6429869 CAGGTGTGAGGGAGGGGTCGTGG - Intronic
1036182659 8:6598434-6598456 GAGGGGAGAAGAAGGGGATGGGG + Intronic
1036272019 8:7314503-7314525 GAGGTGTGAAGCAAAAGATGAGG - Intergenic
1036349326 8:7995842-7995864 GAGGTGTGAAGCAAAAGATGAGG + Intergenic
1036423268 8:8617962-8617984 CAGGGGTGAAGCTGGGGATGAGG - Intergenic
1036561748 8:9904671-9904693 GAGAGGTGGAGGAGGGCATGGGG - Intergenic
1036686504 8:10914962-10914984 GAGATGTGCAGGAGGGGAGGCGG - Intronic
1037121070 8:15287649-15287671 GAGATGTGGAGAGGGGGATGAGG + Intergenic
1037224509 8:16568971-16568993 TAGGTGTGGAGGTGGGGCTGAGG - Intergenic
1037567117 8:20127196-20127218 GAGGTGCAAAGGCGGGGCTGTGG + Intergenic
1037967776 8:23147139-23147161 GAGCTGAGTGGGAGGGGATGGGG - Intronic
1037996974 8:23359841-23359863 GAGGTGTGAAGGTTGGGCTGGGG - Intronic
1038040326 8:23718665-23718687 GTGGAGTGAATGAGGGGAAGAGG + Intergenic
1038232779 8:25719664-25719686 TTGGTGTGAGGTAGGGGATGAGG + Intergenic
1038420290 8:27430215-27430237 GAGGGGTGGAGGAGAGGGTGAGG - Intronic
1040703490 8:50096415-50096437 TAATTGTGAAGGAGGCGATGGGG + Intronic
1040895693 8:52366213-52366235 GAGGTGGGAAGTAGGGGCAGTGG - Intronic
1040917213 8:52574557-52574579 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1041184533 8:55285489-55285511 GAGGAGAGAAGGAGGGAAGGAGG + Intronic
1041451659 8:58012811-58012833 GGGGAGTGGAGGAGTGGATGAGG + Intronic
1041978193 8:63823839-63823861 TAAGTGTGAAGGCTGGGATGAGG - Intergenic
1042101994 8:65283892-65283914 GAGAGGGGAAGGAGGGGAGGTGG + Intergenic
1042441221 8:68828970-68828992 GATGTGTGAAGCCAGGGATGTGG + Intergenic
1042808608 8:72799123-72799145 GAGGTGAGAAGATGGTGATGGGG - Intronic
1043111973 8:76196819-76196841 CACGTCTGAAGGTGGGGATGAGG + Intergenic
1043137556 8:76547559-76547581 GAGGTGTGAAGAAAGAGAAGAGG - Intergenic
1043267097 8:78279974-78279996 CAGGTGTAAAGGAGGGGTGGAGG - Intergenic
1043825676 8:84925778-84925800 AAGGTGTGAAGCAGGGGAGAGGG + Intergenic
1043844882 8:85152663-85152685 GAGGTGTGGAGGGAGAGATGTGG + Intergenic
1043859400 8:85298452-85298474 GAGGCCTGAAGGCAGGGATGTGG - Intergenic
1044835862 8:96295254-96295276 GAGGTAAGAAGGAGGGCATTGGG + Exonic
1045976880 8:108139444-108139466 GAGGTGAGAAGGGGATGATGGGG - Intergenic
1046145615 8:110154177-110154199 GAGCTTTAAAGGAAGGGATGTGG + Intergenic
1046868361 8:119176215-119176237 GGTGTGACAAGGAGGGGATGTGG + Intronic
1047292063 8:123540258-123540280 GAGGTGCAAAGGAGGGAAGGGGG - Intronic
1047976998 8:130140512-130140534 GAGGTGAGGAGGATGGGAGGAGG - Intronic
1048204741 8:132406284-132406306 AAGGTGGGAAGGAGGGGACTCGG + Intronic
1048445467 8:134489657-134489679 GATGATGGAAGGAGGGGATGTGG - Intronic
1048527341 8:135215086-135215108 GAGGTGTGGTAGAGGGAATGTGG - Intergenic
1049146831 8:141006565-141006587 GTATTTTGAAGGAGGGGATGTGG - Intergenic
1049214807 8:141402677-141402699 GAGGTATGGGGGAGGGGAAGAGG - Intronic
1050024568 9:1320571-1320593 GAAGTTTGCAGGAGGGGAAGGGG - Intergenic
1050309656 9:4339856-4339878 GAGGGGTGGGGGAGGGGAGGGGG + Intronic
1051288506 9:15521426-15521448 GAGGTGGGATGGAGGGGGTGCGG - Intergenic
1051350310 9:16192509-16192531 GAGGTGGGAAGGGAGGGAGGGGG - Intergenic
1053111705 9:35466410-35466432 GAAGTGGGAAGGTGGGGAGGAGG + Intergenic
1053280022 9:36814388-36814410 GAGGTAGGAAAGAGAGGATGAGG + Intergenic
1053484350 9:38440914-38440936 TAGGAGAGGAGGAGGGGATGGGG - Intergenic
1053528024 9:38849082-38849104 TGGGTGTGAAGCAGGGGAGGGGG - Intergenic
1054200245 9:62073515-62073537 TGGGTGTGAAGCAGGGGAGGGGG - Intergenic
1054638110 9:67514849-67514871 TGGGTGTGAAGCAGGGGAGGGGG + Intergenic
1054714269 9:68541590-68541612 GAGGTGTGGAGGAGAGGACAGGG - Intergenic
1054998483 9:71421211-71421233 GAGGTGGGAAGGAAGGAAGGGGG + Intronic
1055043594 9:71901698-71901720 GAGGAATGAAGAGGGGGATGGGG - Intronic
1056123109 9:83509006-83509028 GAGGAGGCAAGGAGGGGAGGGGG - Intronic
1056817412 9:89811765-89811787 GTGGGGAGGAGGAGGGGATGGGG + Intergenic
1057123460 9:92598271-92598293 AAGGAGTGAAGGAGGGGAGAAGG + Intronic
1057195805 9:93115256-93115278 TTGGTGTGAGGGAGGGGTTGTGG + Intergenic
1057195928 9:93115641-93115663 GAGGGGTAAGGGAGGGGGTGAGG + Intergenic
1057195943 9:93115688-93115710 GAGGAGTGAGGGAGGGGATGAGG + Intergenic
1057195951 9:93115711-93115733 GAGGAGTGAGGGAGGGGATAAGG + Intergenic
1057195973 9:93115768-93115790 GAGGGGTGAGGGAGGGGGTGAGG + Intergenic
1057196026 9:93115942-93115964 GGAGAGTGAAGGAGGGCATGGGG + Intergenic
1057196066 9:93116044-93116066 GAGGGGTGAGGGTGGGGGTGAGG + Intergenic
1057605123 9:96493461-96493483 GAGGTGTGGAAAAGGGAATGAGG + Intronic
1057611725 9:96550208-96550230 GAGGTGGGTAGGAAGGGAAGAGG - Intronic
1057818716 9:98315112-98315134 GAGCGGTGAAGGTGGGGTTGCGG - Intronic
1057890217 9:98864320-98864342 GAGGATTGAAGGAGGTGAGGGGG + Intergenic
1058095040 9:100850329-100850351 GAGGTGTGGAGGGTGGGAGGAGG + Intergenic
1058484854 9:105433623-105433645 GAGGGGTGAAGCAGGGGCGGCGG - Intronic
1058781394 9:108339529-108339551 GGGGTGGGAGGGAGGGGGTGGGG + Intergenic
1058834929 9:108852504-108852526 GAGGAGATAAGGAGGGAATGGGG + Intergenic
1059035322 9:110748158-110748180 GAGGAATGAAGGAGGGAATAAGG - Intronic
1059325783 9:113503437-113503459 GGAGTGTGAAGGAGGGGAAGAGG - Intronic
1059612831 9:115917350-115917372 GTGGGGGGCAGGAGGGGATGTGG + Intergenic
1060189404 9:121582512-121582534 GAGGTCTGCAGCAGGGGATGTGG - Intronic
1060486742 9:124052463-124052485 GAGGGGTGAATGAGGAGATGGGG + Intergenic
1060848015 9:126852596-126852618 GAGGCTTGAAGGAGGGCAGGGGG + Intergenic
1060893282 9:127201981-127202003 GAGGTGTGAGAGAGGAGAGGGGG + Intronic
1060947546 9:127579083-127579105 GAGGTGGGAGGGAGGTGGTGGGG - Intergenic
1060951691 9:127608141-127608163 GAGGCTAGGAGGAGGGGATGTGG + Intergenic
1061120912 9:128641704-128641726 GAGATGGGAAGGAGGGAGTGTGG - Intronic
1061512779 9:131071212-131071234 AAGGTGGGGAGGAAGGGATGGGG - Intronic
1061543835 9:131292310-131292332 AAGGTGGGAAGGAAGAGATGGGG - Intronic
1061561666 9:131408095-131408117 GGGGTGGGAAGAAGAGGATGGGG + Intronic
1061681084 9:132242671-132242693 GAGGAGAGAAGGAAGGGGTGGGG + Exonic
1061974042 9:134059513-134059535 GAGGGGTGAAGGAGGGATTGCGG - Intronic
1062153634 9:135034050-135034072 GAGGGGAGAGGCAGGGGATGGGG - Intergenic
1062362612 9:136194768-136194790 GAGGAGGGAAGAAGGGGAAGGGG - Intergenic
1062374440 9:136255621-136255643 GATGGCTGAAGGAGGGGCTGGGG + Intergenic
1062525757 9:136977499-136977521 GAGGTGTGCAGGAGGAGCGGAGG - Exonic
1062748974 9:138237117-138237139 GAGGTGTGAGGGTGAGGATGAGG + Intergenic
1185598872 X:1325418-1325440 GAGGCGGGAAGGAGGGGGGGAGG + Intergenic
1185662042 X:1735632-1735654 GAGGGGGGAAGGAGGGGGAGGGG - Intergenic
1185809270 X:3090064-3090086 GAGGGGTGAAGGAAGGAGTGGGG - Intronic
1185931883 X:4212743-4212765 GTGGTGGGAAGGAGGAGATAGGG - Intergenic
1186206361 X:7204831-7204853 GAGGAAGGAAGGAGGGGAGGAGG - Intergenic
1187269621 X:17768089-17768111 GAGTTGTGAAGTAGTGGATTTGG - Intergenic
1187680859 X:21766790-21766812 GTGGTGTGAATGAAGGGTTGAGG + Intergenic
1187749789 X:22449562-22449584 GAGTTGTGAAGTAGGATATGGGG + Intergenic
1188612157 X:32113798-32113820 GAGGTAGGAATGAGGGCATGAGG - Intronic
1189949547 X:46214527-46214549 GAGGTATGTAGGAAGGGGTGTGG - Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190324747 X:49199758-49199780 AAGGTGTGGGGGCGGGGATGGGG - Intronic
1190438260 X:50449259-50449281 GAGGAGTGAGGGAGGAGATGAGG - Intronic
1190457860 X:50643187-50643209 GAGTAATGAAGGATGGGATGAGG - Intronic
1190862313 X:54357094-54357116 GATGTGTGAGGGACAGGATGGGG - Intronic
1190938668 X:55019471-55019493 GAGATGGGGAGGAGGGGGTGTGG + Intronic
1191054977 X:56232298-56232320 GAGGGAGGAAGGAGGGGGTGGGG - Intergenic
1191183711 X:57588160-57588182 TGGGTGTGAAGTAGGGGTTGGGG - Intergenic
1191627311 X:63283148-63283170 GAGGTGGGCATGAGGGCATGGGG - Intergenic
1191783423 X:64892654-64892676 AAGGTGAGAAGGAGGGACTGTGG + Intergenic
1192053714 X:67750685-67750707 GAGGTATGAGGGAAGGGGTGTGG - Intergenic
1192194780 X:69020996-69021018 GAGGGGAGATGGTGGGGATGGGG + Intergenic
1192459350 X:71303693-71303715 GAGGGGTGAGGGAGGGGACTGGG + Exonic
1192556092 X:72090672-72090694 GAGCTGTTAAAGTGGGGATGGGG - Intergenic
1192703680 X:73504413-73504435 GGGGAGTGATGGAGGGAATGAGG + Intergenic
1192834150 X:74781423-74781445 GAGAGGTGAAGGAGGAGAAGAGG + Intronic
1192836613 X:74806264-74806286 GAGGTGGGACGGAGGGAGTGGGG + Intronic
1193033357 X:76923542-76923564 GAGATGTGAAGAAGGAGAGGAGG - Intergenic
1193744314 X:85257313-85257335 GAGGTGGGAGGGAGGGAGTGGGG - Intronic
1195655510 X:107328109-107328131 TAGGTGTGAAGAATGGGCTGTGG + Intergenic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1196677406 X:118434674-118434696 GAGGTGGGGTGGAGGGGTTGGGG - Intronic
1196871357 X:120116099-120116121 GTGGGGTGCAGGTGGGGATGGGG + Intergenic
1197532150 X:127642667-127642689 GAGGTGGGAGGGAGGGCAAGGGG - Intergenic
1197998245 X:132403996-132404018 GATGTGGGTGGGAGGGGATGGGG - Intronic
1198026938 X:132716136-132716158 GGGGTGTGAGAGAGGAGATGAGG - Intronic
1198187083 X:134264121-134264143 GAGGTGGACAGGATGGGATGGGG - Intergenic
1199610255 X:149606677-149606699 GAGATGGGAAGGAGGAGTTGAGG - Intronic
1200058265 X:153472708-153472730 GAGGTGGGTGGGCGGGGATGTGG + Intronic
1200068056 X:153514395-153514417 GAGGGGTGAGAGTGGGGATGAGG + Intergenic
1200986785 Y:9309378-9309400 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1201549999 Y:15209437-15209459 GGGGAGGGAAGGAGGGGAGGAGG + Intergenic
1202108258 Y:21392941-21392963 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1202118895 Y:21504442-21504464 GAGGGATCAAAGAGGGGATGGGG - Intergenic
1202121347 Y:21527982-21528004 GAGGGATCAAAGAGGGGATGGGG - Intronic
1202123799 Y:21551522-21551544 GAGGGATCAAAGAGGGGATGGGG - Intergenic
1202155209 Y:21877858-21877880 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1202157656 Y:21901400-21901422 GAGGGATCAAAGAGGGGATGGGG + Intronic
1202160102 Y:21924965-21924987 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1202184105 Y:22166325-22166347 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1202207254 Y:22420076-22420098 GAGGGATCAAAGAGGGGATGGGG - Intergenic
1202231254 Y:22661422-22661444 GAGGGATCAAAGAGGGGATGGGG - Intergenic
1202311904 Y:23534743-23534765 GAGGGATCAAAGAGGGGATGGGG + Intergenic
1202558898 Y:26135851-26135873 GAGGGATCAAAGAGGGGATGGGG - Intergenic