ID: 1114187428

View in Genome Browser
Species Human (GRCh38)
Location 14:20413421-20413443
Sequence GAAGTTTCTGCTTCCTGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 280}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114187428_1114187431 -3 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187431 14:20413441-20413463 TTCGCTCTGGATTCTGCCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 49
1114187428_1114187432 -2 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187432 14:20413442-20413464 TCGCTCTGGATTCTGCCGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1114187428_1114187434 3 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187434 14:20413447-20413469 CTGGATTCTGCCGGTGGGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 141
1114187428_1114187437 13 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187437 14:20413457-20413479 CCGGTGGGAAGGGTGGCAGCCGG 0: 1
1: 0
2: 4
3: 37
4: 395
1114187428_1114187439 15 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187439 14:20413459-20413481 GGTGGGAAGGGTGGCAGCCGGGG 0: 1
1: 0
2: 2
3: 68
4: 568
1114187428_1114187438 14 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187438 14:20413458-20413480 CGGTGGGAAGGGTGGCAGCCGGG 0: 1
1: 0
2: 3
3: 37
4: 397
1114187428_1114187435 6 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187435 14:20413450-20413472 GATTCTGCCGGTGGGAAGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 183
1114187428_1114187440 16 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187440 14:20413460-20413482 GTGGGAAGGGTGGCAGCCGGGGG 0: 1
1: 0
2: 1
3: 45
4: 451
1114187428_1114187442 25 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187442 14:20413469-20413491 GTGGCAGCCGGGGGAGGAGCCGG 0: 1
1: 0
2: 7
3: 85
4: 950
1114187428_1114187441 19 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187441 14:20413463-20413485 GGAAGGGTGGCAGCCGGGGGAGG 0: 1
1: 0
2: 2
3: 116
4: 954
1114187428_1114187430 -6 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187430 14:20413438-20413460 AACTTCGCTCTGGATTCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1114187428_1114187433 2 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187433 14:20413446-20413468 TCTGGATTCTGCCGGTGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114187428 Original CRISPR GAAGTTTCTGCTTCCTGCTG CGG (reversed) Exonic