ID: 1114187440

View in Genome Browser
Species Human (GRCh38)
Location 14:20413460-20413482
Sequence GTGGGAAGGGTGGCAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 451}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114187426_1114187440 23 Left 1114187426 14:20413414-20413436 CCGATTCCCGCAGCAGGAAGCAG 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1114187440 14:20413460-20413482 GTGGGAAGGGTGGCAGCCGGGGG 0: 1
1: 0
2: 1
3: 45
4: 451
1114187427_1114187440 17 Left 1114187427 14:20413420-20413442 CCCGCAGCAGGAAGCAGAAACTT 0: 1
1: 0
2: 4
3: 26
4: 247
Right 1114187440 14:20413460-20413482 GTGGGAAGGGTGGCAGCCGGGGG 0: 1
1: 0
2: 1
3: 45
4: 451
1114187428_1114187440 16 Left 1114187428 14:20413421-20413443 CCGCAGCAGGAAGCAGAAACTTC 0: 1
1: 0
2: 1
3: 16
4: 280
Right 1114187440 14:20413460-20413482 GTGGGAAGGGTGGCAGCCGGGGG 0: 1
1: 0
2: 1
3: 45
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114187440 Original CRISPR GTGGGAAGGGTGGCAGCCGG GGG Intergenic