ID: 1114190032

View in Genome Browser
Species Human (GRCh38)
Location 14:20433986-20434008
Sequence ATGGCCTAGTGGAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114190026_1114190032 9 Left 1114190026 14:20433954-20433976 CCCTTGTAATTTTAAACTTTCAA 0: 1
1: 0
2: 4
3: 83
4: 715
Right 1114190032 14:20433986-20434008 ATGGCCTAGTGGAAGGAGACTGG 0: 1
1: 0
2: 2
3: 38
4: 451
1114190027_1114190032 8 Left 1114190027 14:20433955-20433977 CCTTGTAATTTTAAACTTTCAAT 0: 1
1: 1
2: 4
3: 74
4: 748
Right 1114190032 14:20433986-20434008 ATGGCCTAGTGGAAGGAGACTGG 0: 1
1: 0
2: 2
3: 38
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114190032 Original CRISPR ATGGCCTAGTGGAAGGAGAC TGG Intronic
901565743 1:10113331-10113353 CGGGCCTAGTGGGAGGTGACTGG - Intronic
902311100 1:15582477-15582499 ATGGCATAGTGGGAGGAGTGTGG - Intronic
902423747 1:16302894-16302916 GTGACCTGGTGGGAGGAGACTGG - Intronic
902459535 1:16563102-16563124 ATGGACTATGTGAAGGAGACAGG + Exonic
902580999 1:17407535-17407557 AAGGCCCTGTGGGAGGAGACTGG - Exonic
903300713 1:22376697-22376719 GGGGCCTAGTGGAAGGTGATTGG + Intergenic
903376595 1:22870311-22870333 ATGGCCCCGAGGAAGGAGGCTGG + Intronic
904436722 1:30503724-30503746 ATGGCTTGGTGGAAGGAAGCTGG + Intergenic
904697045 1:32336471-32336493 GGGGCCTGGAGGAAGGAGACGGG + Intergenic
904959139 1:34317147-34317169 GGGGCATAGTGGAAGGAGATTGG + Intergenic
905734422 1:40315975-40315997 CTGGCACAGTGGAAGGAGTCGGG - Intronic
906999338 1:50834031-50834053 AGGGCCTGGTGGCAGGCGACTGG + Intronic
907315271 1:53566623-53566645 AGGGCCTGGTGGGAGGTGACTGG + Intronic
908096154 1:60741208-60741230 ATGGCCAAGAGGGTGGAGACAGG + Intergenic
909741789 1:79037981-79038003 AGGGCCTAGTGGGAGGTGATTGG + Intergenic
910191953 1:84604115-84604137 ATGGCAAAGTGAAAGGAAACTGG - Intergenic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
911191803 1:94955871-94955893 CTGGCCTAGTGGAAGATGAGAGG - Intergenic
911933672 1:103938142-103938164 GGGGCCTAGTGGAAGGTGATTGG + Intergenic
912017727 1:105062164-105062186 AGGGCCTAGTGGGAGGTGACTGG - Intergenic
912128794 1:106575020-106575042 AGGGCCTGGTGGAAGGTGATTGG + Intergenic
912272231 1:108223241-108223263 ATGGACTGTTTGAAGGAGACAGG + Intergenic
913142243 1:115953172-115953194 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
913330598 1:117663907-117663929 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
913606054 1:120467040-120467062 ATGGACTATGTGAAGGAGACAGG - Intergenic
913644241 1:120841412-120841434 ATGGACTATGTGAAGGAGACAGG - Intronic
914082504 1:144422172-144422194 ATGGACTATGTGAAGGAGACAGG + Exonic
914177403 1:145290685-145290707 ATGGACTATGTGAAGGAGACAGG + Exonic
914210375 1:145573124-145573146 ATGGACTATGTGAAGGAGACAGG + Intergenic
914269299 1:146065477-146065499 ATGGACTATGTGAAGGAGACAGG + Exonic
914367798 1:146995394-146995416 ATGGACTATGTGAAGGAGACAGG - Exonic
914485182 1:148102828-148102850 ATGGACTATGTGAAGGAGACAGG + Exonic
914532132 1:148532164-148532186 ATGGACTATGTGAAGGAGACAGG + Exonic
914636264 1:149555557-149555579 ATGGACTATGTGAAGGAGACAGG - Intergenic
915331700 1:155116736-155116758 ATGGGCGAGGGGAAGGTGACAGG - Intergenic
915604542 1:156942307-156942329 ATGGTACAGTGGAAGGAGACAGG - Intronic
915936037 1:160090918-160090940 AGGGCCTAGTGGGAGGAGTCAGG + Intergenic
916501603 1:165392378-165392400 GTGGCCCAGTGGAAGGAGCAGGG - Intergenic
918137044 1:181682873-181682895 GGGGCCTGGTGGAAGGTGACCGG - Intronic
918251484 1:182707242-182707264 GTAGCCTAATGGAAGGAGGCTGG + Intergenic
918323247 1:183384583-183384605 GGGGCCTAGTGGAAGGTGACTGG - Intronic
919988052 1:202689518-202689540 GTGGCCTTGTGGGAGGAGTCCGG + Intronic
920112858 1:203599308-203599330 AGGGTCTAGGGGAAGGAGAAAGG - Intergenic
921014042 1:211170624-211170646 ATGGCCTGGTGGGAGGTGATTGG - Intergenic
921771582 1:219046970-219046992 AGGGCCTGGTGGAAGGTGACTGG - Intergenic
922537562 1:226392396-226392418 GTGTCCTAGTGGAAGGATCCTGG - Intronic
923010717 1:230085481-230085503 ATGGCCCAGTGGCAGTGGACTGG - Intronic
923885221 1:238146844-238146866 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
924823385 1:247515788-247515810 GGGGCCTAGTGGGAGGTGACTGG - Intronic
924825535 1:247534198-247534220 ATGATCTAGTGGAGCGAGACGGG - Intronic
924934566 1:248757118-248757140 ATGGCACAGTGTGAGGAGACTGG - Intergenic
1063534751 10:6872498-6872520 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1063877849 10:10498510-10498532 AAAGCATAGTGTAAGGAGACTGG + Intergenic
1064225594 10:13481613-13481635 CTGGCATAGTAGAAGGAGCCAGG - Intronic
1064842703 10:19612865-19612887 GGGGCCTAGTGGGAGGTGACTGG - Intronic
1065430371 10:25648665-25648687 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
1067263114 10:44712130-44712152 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1068133685 10:52927696-52927718 ATGGTCCAGTGGCAGGAGGCTGG + Intergenic
1068340761 10:55699325-55699347 AGGGCCTAGTGGAAGGTGTTTGG + Intergenic
1068655377 10:59569426-59569448 TTAGCCAAGTGGAAGAAGACAGG - Intergenic
1068975457 10:63004084-63004106 AGGGCCTAGTGGGAGGTGATTGG - Intergenic
1071664538 10:87541883-87541905 AGGGCCTGGTGGGAAGAGACTGG - Intronic
1071962308 10:90818807-90818829 AAGGCCTGGTGGAAGGTAACTGG + Intronic
1071977598 10:90970583-90970605 AGGGCCTGGTGGGAGGCGACTGG + Intergenic
1072440937 10:95454525-95454547 GTGGCAAAGTGGAAGGAGCCTGG - Intronic
1073735496 10:106341230-106341252 ATGGGCAAGGGGAAGGAGAGAGG - Intergenic
1074239515 10:111623067-111623089 ATAGCCTAGCAGAAGGAGATAGG - Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1076614038 10:131744604-131744626 ATCCCCCACTGGAAGGAGACAGG + Intergenic
1078253734 11:9639538-9639560 ATGGCCTGATGGAAGGAGCCTGG + Intergenic
1078520261 11:12057304-12057326 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1078599556 11:12718133-12718155 ATGACATGGTGGGAGGAGACAGG - Intronic
1080289112 11:30651379-30651401 ATGGCCTAGTTGAAGAGGTCAGG + Intergenic
1081574465 11:44310498-44310520 AGGGGCCAGTGGAAGGAGAGAGG - Intergenic
1082570219 11:54729208-54729230 AGGGCCTTGTGGGAGGTGACTGG - Intergenic
1082616978 11:55372587-55372609 AGGGCCTTGTGGGAGGTGACTGG - Intergenic
1082993085 11:59225699-59225721 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1083554807 11:63617674-63617696 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
1084315809 11:68344667-68344689 AGGGACTAGGGGAGGGAGACTGG - Intronic
1084404426 11:68962895-68962917 GTGGCCTGGTGGAAGGTGATTGG + Intergenic
1084435033 11:69134475-69134497 AAGGCCTGGTGGGAGGTGACTGG - Intergenic
1084722508 11:70916320-70916342 ATGGCCTAGTTGCAGCAGAGTGG + Intronic
1086064240 11:82730162-82730184 AGGTCCTAGTGGAAGGTGATTGG - Exonic
1086294055 11:85345589-85345611 ATGGCCCAGTGAAAGGATAATGG - Intronic
1086500025 11:87443222-87443244 ATTACCTAGTGAAAGGTGACTGG + Intergenic
1086926970 11:92651250-92651272 GTGGTTTAGTGGAAGAAGACAGG + Intronic
1087462128 11:98458753-98458775 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
1087574687 11:99975714-99975736 AGGGCCTAGTGGGAGGTGATTGG - Intronic
1087891094 11:103539035-103539057 ACAGCCTGGTGGAAGGTGACTGG - Intergenic
1089028453 11:115296381-115296403 AAGGCCTAGTGGGAGGTGTCTGG + Intronic
1089193880 11:116679627-116679649 ATTTCCTAGAGGAAGGAGTCAGG - Intergenic
1089451873 11:118604348-118604370 AGGGCTTATTGGAAGGAGACAGG + Intergenic
1089995471 11:122902824-122902846 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1090262312 11:125330458-125330480 ATGTCCTCTTGGAAGGAGCCTGG + Intronic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090887965 11:130895966-130895988 ATGGCCTAATGGAAGAGGCCTGG + Intronic
1091972943 12:4803569-4803591 GTGGCCAAGTGGATGGAGTCAGG - Intronic
1092168236 12:6356178-6356200 ATGGCCTGGTGAGAGGAGCCTGG - Intronic
1093188471 12:16048902-16048924 GGGGCCTAGTGGAAGGTGATTGG + Intergenic
1093635132 12:21457813-21457835 ACGGCCTGGTGGGAGGTGACTGG - Intronic
1093808614 12:23465771-23465793 TTGGAGTACTGGAAGGAGACAGG + Intergenic
1094287061 12:28807422-28807444 ATGGCCTAGTGGTGGCAGGCTGG - Intergenic
1094467199 12:30766027-30766049 ATGGCATAGTAGAAAGAGAACGG + Intergenic
1094474692 12:30832311-30832333 GTGGCCTGGTGGGAGGTGACTGG - Intergenic
1095506619 12:42905501-42905523 GTGGCCTAGTGGGAGGTAACAGG + Intergenic
1095801468 12:46273503-46273525 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1095909112 12:47408028-47408050 ATGGCCTAGTGGCTGCAGAATGG - Intergenic
1096031641 12:48421409-48421431 AGGGCCTAGTGGGAGGTAACTGG - Intergenic
1096627040 12:52902281-52902303 ATTGGGTAGGGGAAGGAGACAGG + Intronic
1096905207 12:54929368-54929390 ATTGCCTAGGGCAATGAGACAGG - Intergenic
1097375223 12:58835326-58835348 GGGGCCTAGTGGAAGGTGATTGG - Intergenic
1097520090 12:60656578-60656600 AGGGCCTAGTGGGAGGTGATTGG + Intergenic
1097790429 12:63809787-63809809 AGGGCCTGGTGGGAGGAGATTGG - Intergenic
1098198335 12:68026435-68026457 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1098745844 12:74235807-74235829 TGGGCCTAGTGGGAGGTGACTGG + Intergenic
1099033568 12:77559242-77559264 GTGGCCTGGTGGAAGGTGATTGG - Intergenic
1099122607 12:78710601-78710623 GTGGCCTAGTGGAAGGTGATTGG + Intergenic
1099259102 12:80354067-80354089 GTGGCCTAGTGGGAGGTGTCTGG + Intronic
1099360610 12:81695301-81695323 AGGGCCTGGTGGAAGGTGTCTGG + Intronic
1099476119 12:83109361-83109383 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1099658555 12:85526412-85526434 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
1100153787 12:91773217-91773239 AAGGCCTGGTGGAAGGTGATTGG - Intergenic
1103179641 12:118898944-118898966 ACAGTCTAGTGGAAAGAGACAGG + Intergenic
1104788017 12:131462523-131462545 ATGCCCTAGTTGAAGAGGACTGG - Intergenic
1104936418 12:132366692-132366714 ATCGCCCCGTGGAAGGGGACTGG + Intergenic
1105939539 13:25135080-25135102 ATGCTCTAGTGAAAGGTGACAGG - Intergenic
1106209428 13:27627771-27627793 ATGGGTGAGTGGAAGGAAACTGG + Intronic
1107006594 13:35619413-35619435 ATGGCTCAGTGGCAGCAGACTGG + Intronic
1107224336 13:38028959-38028981 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1107342870 13:39427807-39427829 AGGGCCTGGTGGAAGATGACTGG + Intronic
1107979167 13:45717950-45717972 AGGGCCAAATGGAAGAAGACAGG - Intergenic
1108174401 13:47777487-47777509 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1108378018 13:49831208-49831230 ATGGTTTAGTGGAGGGAGACTGG - Intergenic
1110079830 13:71296086-71296108 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
1110893537 13:80719986-80720008 AGGGCCTGGTGGAAGGTGATAGG - Intergenic
1111597355 13:90428397-90428419 CTGGCCATGTTGAAGGAGACAGG + Intergenic
1112022458 13:95383623-95383645 ATGGCATAGTCAAAGGAGAAGGG + Intergenic
1112291192 13:98144573-98144595 GTTGCCTACTGGAAGGAGAGGGG - Intronic
1112295242 13:98180383-98180405 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1113301595 13:109027524-109027546 GTGGCATAGTGGAAGGAGGGTGG + Intronic
1113499839 13:110764491-110764513 AGGGCCTGGTGGAAGGTGATTGG + Intergenic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1114190032 14:20433986-20434008 ATGGCCTAGTGGAAGGAGACTGG + Intronic
1114566186 14:23634782-23634804 GGGGCCTAGTGGAAGGTGATTGG + Intronic
1114651315 14:24286381-24286403 ATGGACTAGAGGGAGGAGAGAGG - Intergenic
1115156119 14:30341150-30341172 ATGGCCCAGTGGCAGCAGGCTGG + Intergenic
1115895662 14:38084247-38084269 AGGGCCTAGTGGAAGGTGTTTGG + Intergenic
1116211718 14:41954737-41954759 GGGGCCTGGTGGAAGGAGACTGG - Intergenic
1116998434 14:51347809-51347831 AGGGCCTAGTGGGAGGTGATTGG + Intergenic
1118520410 14:66576378-66576400 ATGGCATAATGGAAGGAGAAAGG + Intronic
1118748503 14:68790632-68790654 ATGGCCTATGGGAGGGAGAGAGG - Intronic
1119128524 14:72150751-72150773 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1119554553 14:75543066-75543088 AAGGGCTAGAGGAAGGAGCCAGG + Intronic
1120767068 14:88337939-88337961 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
1122877429 14:104675202-104675224 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1124625696 15:31306433-31306455 CTGGCCTGGAAGAAGGAGACTGG - Intergenic
1125499303 15:40228807-40228829 ACGGCCTTGTGGAATGAGAATGG - Intergenic
1125980676 15:43997902-43997924 GAGGCCTACTGGAAGTAGACCGG - Intronic
1126498419 15:49318093-49318115 CAGGCCTAGGGGAAAGAGACAGG - Intronic
1127602204 15:60549015-60549037 ATGGTCTTGTGGAAGAAAACAGG + Intronic
1127954080 15:63837239-63837261 ATGGTCTAATGGGAGGAGAGAGG + Intergenic
1128081460 15:64859656-64859678 CTGGCCTTGTGGAAAGAGCCCGG - Intronic
1128552196 15:68605437-68605459 AAGGCCTAATGGTATGAGACTGG + Intronic
1129552377 15:76466952-76466974 AGGGCCTGGTGGGAGGTGACTGG + Intronic
1130577784 15:85107577-85107599 CTGACCCAGTGGAAGGAGAGGGG + Intronic
1130603451 15:85294061-85294083 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1130752413 15:86726339-86726361 ATGGGATAGTGGGAGGAGAGTGG + Intronic
1131271916 15:90952814-90952836 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1131463951 15:92639617-92639639 GGGGCCTGGTGGAAGGTGACTGG + Intronic
1131522516 15:93127046-93127068 ATACACAAGTGGAAGGAGACGGG + Intergenic
1131873418 15:96782229-96782251 GTAGCCTAGGGGAAGGGGACAGG - Intergenic
1131881458 15:96867183-96867205 ATGTCCCAGTGGGAGGACACTGG + Intergenic
1132641106 16:979031-979053 CTGGCCTTGTGGAGGGAGGCAGG - Intronic
1132981941 16:2742724-2742746 CTGGGCTGGTGGAAGGAGCCAGG + Intergenic
1133697199 16:8276073-8276095 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1134332436 16:13263332-13263354 GGGGCCTGGTGGGAGGAGACTGG + Intergenic
1135738499 16:24953418-24953440 AGGGCCTGGTGGGAGGTGACTGG + Intronic
1138345828 16:56319638-56319660 ATGTCCTCGTGGCAGGACACAGG + Intronic
1139665753 16:68454250-68454272 ATGGCCAGTTTGAAGGAGACAGG + Intergenic
1140202543 16:72906175-72906197 AGCTCCTAGTGGAATGAGACTGG + Intronic
1141817333 16:86421224-86421246 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
1143400290 17:6638833-6638855 AGGGCCTTGGGGAAGGACACGGG - Intronic
1143427314 17:6850228-6850250 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1144193839 17:12871624-12871646 GGGGCCTAGTGGGAGGTGACTGG - Intronic
1144413612 17:15024438-15024460 ATGACCTAGTGGGAGATGACAGG - Intergenic
1145842865 17:28010783-28010805 AGGGCCTAGTGGGAGGTGATTGG + Intergenic
1146536341 17:33656011-33656033 ATGGCATAGTGGAAGTAGAAAGG + Intronic
1146757076 17:35442273-35442295 ATGTCCTGGTGGAACTAGACAGG + Exonic
1147695270 17:42347639-42347661 GGGGCCTGGTGGAAGGTGACTGG + Intronic
1150679665 17:67274601-67274623 ATGTCCTAGTTGAAGAAGAGAGG - Intergenic
1150813142 17:68372620-68372642 GGGGCCTGGTGGAAGGCGACTGG - Intronic
1151082943 17:71349432-71349454 GGGGCCTGGTGGGAGGAGACTGG - Intergenic
1151356343 17:73560894-73560916 AAGGACTTGTGGCAGGAGACAGG + Intronic
1152623505 17:81377908-81377930 CTGGCCTCGTGGCAGGAGGCTGG + Intergenic
1152749410 17:82055722-82055744 CAAGCCTAGTGGAAGGAGCCGGG - Exonic
1153087774 18:1308110-1308132 AGGGGCTAGTGGGAGGTGACTGG - Intergenic
1153287589 18:3470582-3470604 ATGGCCTGGTGGGTGGAGCCAGG + Intergenic
1154254495 18:12770701-12770723 ATGGCCACGTGGTAGGAGAAAGG - Intergenic
1155541228 18:26870540-26870562 ATTGTGTAGTGGAAGGAGAAGGG + Intergenic
1156812653 18:41271657-41271679 GGGGCCTAGTGGGAGGTGACGGG + Intergenic
1157525640 18:48378366-48378388 AGTGCCTAGTGGATGAAGACTGG - Intronic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1158504900 18:58038848-58038870 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
1158542405 18:58369260-58369282 AAGGCCTTGTGGAAGAAGATGGG + Intronic
1158860955 18:61591952-61591974 AGGGCCTTGTGGGAGGTGACTGG + Intergenic
1158870821 18:61686129-61686151 GAGGCCTAGTGGGAGGTGACTGG - Intergenic
1159952086 18:74492040-74492062 ATGGCCAAGAGGATGGAGAGAGG + Intergenic
1166118756 19:40672211-40672233 ATGGGCCAGGGAAAGGAGACAGG - Intronic
1166182713 19:41120214-41120236 AGGGCTTACTGGAAGGAGCCAGG + Intronic
1166784559 19:45359745-45359767 AGGGACTAGAGGCAGGAGACTGG - Intronic
1202675780 1_KI270711v1_random:5286-5308 ATGGACTATGTGAAGGAGACAGG + Intergenic
924971867 2:135774-135796 AGGGCCTGGTGGAAGGTGATCGG + Intergenic
925044282 2:759810-759832 CTGGCCTAGATAAAGGAGACTGG - Intergenic
925771111 2:7283968-7283990 GTGCCCTGGTGGATGGAGACGGG + Intergenic
925878495 2:8331690-8331712 ATAGCATAGTGCAAGGAGGCAGG + Intergenic
926260541 2:11256249-11256271 AGGGCCTAGTGGGAGGTGACTGG + Intronic
926653403 2:15371052-15371074 ATGACCTGGTGGAAGGTGACTGG + Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927031280 2:19123005-19123027 AAGGCCTGGTGGGAGGTGACTGG - Intergenic
927167024 2:20333810-20333832 GGGGCCTAGTGGAGGGTGACTGG + Intronic
927395659 2:22648054-22648076 GAGGCCTGGTGGGAGGAGACTGG + Intergenic
927895870 2:26781479-26781501 GGGGCCTAGTGGGAGGTGACTGG - Intronic
927919739 2:26962789-26962811 ATGGGATAGTGGAAGAAGTCTGG + Intergenic
928244298 2:29614117-29614139 ATGGTCTAGGGAAAGGAGCCTGG - Intronic
928272603 2:29870462-29870484 GGGGCCTAGTGGGAGGTGACTGG - Intronic
928791552 2:34961932-34961954 ATGGCCTGGTGGGAGGTGATTGG + Intergenic
928933393 2:36648709-36648731 AGGGCCTAATGGATGAAGACAGG - Intergenic
929921937 2:46178904-46178926 AGGGCAGGGTGGAAGGAGACTGG + Intronic
930349917 2:50237853-50237875 AGGGCCTGGTGGAAGGTGATGGG + Intronic
930618725 2:53622613-53622635 ATGGTCTATTTGAAGGATACTGG + Intronic
931070143 2:58637798-58637820 ATGGCTTGGTGGCAGGAGAGTGG + Intergenic
934041243 2:88129261-88129283 ATGGCCTAGTGTCACGTGACGGG + Intergenic
934536399 2:95137872-95137894 GGGGCCTAGTGGGAGGTGACTGG + Intronic
935437268 2:103048235-103048257 TTTGCATAGTGGAAGGTGACAGG + Intergenic
936728191 2:115348051-115348073 ATGGCAGAGAGGTAGGAGACAGG + Intronic
936892288 2:117385977-117385999 CTGGCCTTGTAGAATGAGACAGG + Intergenic
937314450 2:120922081-120922103 ATGGCCCAGTGAGAGGAGACAGG - Intronic
938404771 2:131025335-131025357 GTGGCCTGGTGGAAGGTGATTGG - Intronic
939269636 2:139921105-139921127 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
941076103 2:161008254-161008276 ATGGCCTTGGGGAAGGACATTGG - Intergenic
943702636 2:191003449-191003471 GGGGCCTGGTGGAAGGTGACTGG + Intronic
944047630 2:195431212-195431234 AAGGCCTAGTGGGAGGTTACTGG + Intergenic
945125543 2:206505676-206505698 AGGGCCTTGTGGAAAGTGACTGG - Intronic
945235714 2:207629586-207629608 ATGGACTAGTTCCAGGAGACAGG - Intergenic
946418236 2:219551257-219551279 ATGGTCCAGTGGCAGGAGAGAGG + Intronic
946699524 2:222397680-222397702 GGGGCCTAGTGGGAGGAGATTGG + Intergenic
947128643 2:226898110-226898132 AGGGCCTAATGGGAGGTGACTGG - Intronic
947274374 2:228373562-228373584 AGGGCCTAGTGGGAGGTGATTGG - Intergenic
947989311 2:234474265-234474287 TTGGACTAGAGGAAGGAGCCAGG + Intergenic
948590396 2:239046017-239046039 GTGGCCTCGTGGAAGAAGAGTGG + Intergenic
1168796458 20:612994-613016 ATACTCTAGTGGAGGGAGACAGG - Intergenic
1168868070 20:1105909-1105931 ATGGCCTGGTGGAAAAAGGCTGG - Intergenic
1170031411 20:11947971-11947993 ATGGCAGAGGGGAAGGCGACTGG + Intergenic
1170090966 20:12589437-12589459 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
1170261655 20:14415012-14415034 ATTCCCTAGTAGAAAGAGACAGG - Intronic
1170866688 20:20164032-20164054 ATGTCCTAGAGCAAGGAGACAGG - Exonic
1171022226 20:21596125-21596147 ATGTCCTTGAGGCAGGAGACTGG - Intergenic
1171421716 20:25022005-25022027 ATGGCCAAGTGTAAGGAAATGGG + Intronic
1173365500 20:42381122-42381144 AGGGCCTGGTGGAAGGTGATTGG - Intronic
1173504470 20:43576076-43576098 ATGGCAGACTGGAAAGAGACAGG - Intronic
1173662878 20:44746151-44746173 ATGGCGAAGTAGAAGGAGCCGGG - Exonic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1175700399 20:61132741-61132763 ATGTTCTAGTGGAAGGAGACAGG - Intergenic
1176672227 21:9745253-9745275 AGGGGCAAGAGGAAGGAGACAGG + Intergenic
1176946734 21:14991095-14991117 ATTGCCTAAAGGAAGGAGTCAGG + Intronic
1178392236 21:32208278-32208300 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1178816548 21:35935249-35935271 ATAGTCCAGTGGAGGGAGACAGG - Intronic
1179020867 21:37639752-37639774 GTGGCCTGGTGGAAGACGACTGG + Intronic
1179395509 21:41036476-41036498 AAGCCCAAGGGGAAGGAGACAGG + Intergenic
1180582399 22:16851843-16851865 ATGGCCTAGTGGGAGGTGTTTGG - Intergenic
1181074770 22:20368278-20368300 AAAGCCTGGTGGAAGGAGATTGG - Intronic
1181796213 22:25312870-25312892 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1181836762 22:25616505-25616527 GGGGCCTGGTGGAAGGTGACTGG - Intronic
1182234903 22:28867437-28867459 ATGGCCTAGTAGGAGGAAACGGG + Intergenic
1182235358 22:28870944-28870966 GTGGCCTGGTGGGAGGTGACTGG + Intergenic
1183346724 22:37312205-37312227 AGGGCCTTCTGGAAGGTGACGGG - Intronic
1183676708 22:39302890-39302912 ATGGCATAGTGGACAGTGACCGG - Intergenic
1184306199 22:43603899-43603921 GGGGCCTAGTGGGAGGTGACTGG + Intronic
950004734 3:9684488-9684510 TTGGCCTGGTGGAGGGAGCCAGG - Intronic
950454895 3:13086814-13086836 ATGGCCTAGAGGAAGTAAACTGG - Intergenic
950731795 3:14966213-14966235 CTGGCCTATGGGAAGGAAACTGG - Intronic
950758707 3:15201477-15201499 TTGGCCTACTGGGAGGACACAGG - Intergenic
950972585 3:17203587-17203609 AGGGCCTGGTGGGAGGTGACTGG + Intronic
952082112 3:29771909-29771931 GGGGCCTAGTGGGAGGTGACTGG - Intronic
952411912 3:33057046-33057068 AGGGCCTGGTGGCAGGCGACTGG + Intronic
952738879 3:36716634-36716656 ATGGCATAGTGGGAAGAGGCTGG + Intronic
952978205 3:38714128-38714150 CAGTCCTCGTGGAAGGAGACAGG + Intronic
953717850 3:45331146-45331168 ATGGCCTGGTGGCAGGGCACTGG + Intergenic
954415869 3:50393021-50393043 ATGGCCTGGGGGATGGGGACTGG + Intronic
954644830 3:52124842-52124864 AGCGCTTAGTGGAAGGAGGCTGG - Intronic
955023806 3:55147481-55147503 ATGTCCTACTGCAAGGGGACCGG + Intergenic
955109067 3:55929681-55929703 AGGGCCTAGTGGGAGGGGACTGG + Intronic
955522101 3:59785003-59785025 AAGGCAAAGTGGAAGCAGACAGG + Intronic
956292329 3:67674222-67674244 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
957131622 3:76230241-76230263 ATGGGCTAGTGGATGGAGTCAGG - Intronic
957462381 3:80538043-80538065 CTGGCCTAGTGGGAGGAGTTTGG - Intergenic
957553066 3:81731603-81731625 GGGGCCTGGTGGAAGGCGACTGG + Intronic
959105130 3:102057114-102057136 GAGGCCTAGTGGGAGGTGACAGG - Intergenic
959202068 3:103259817-103259839 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
960429908 3:117556653-117556675 GGGGCCTAGTGGAAGGTGATTGG + Intergenic
960913573 3:122674658-122674680 AGGGCCTAGTGGGAGGTGATTGG - Intergenic
960971656 3:123144108-123144130 ATGGCCTTGGAGGAGGAGACAGG + Intronic
961910592 3:130312317-130312339 AGGGCCTACTGGAAGGTGAAGGG + Intergenic
962329302 3:134463688-134463710 ATGGCATGGTGCAAGGAGGCTGG + Intergenic
962507894 3:136066791-136066813 GGGGCCTGGTGGAAGGTGACTGG - Intronic
964841079 3:160994324-160994346 ATGGCCCAGTGGCAGCAGGCTGG + Intronic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965392143 3:168118014-168118036 CTGGCCTACAGGAAGAAGACAGG + Intergenic
965619188 3:170625433-170625455 GGGGCCTGGTGGAAGGAGATTGG + Intronic
965781843 3:172294534-172294556 AGGGCCTGGTGGGAGGTGACTGG - Intronic
965813948 3:172617948-172617970 AGGGTCTGGTGGAAGGTGACTGG - Intergenic
965966002 3:174490382-174490404 ATTTCCTAGGGGAAGGAGAAAGG + Intronic
966972658 3:185059839-185059861 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
967441526 3:189514514-189514536 AGGGCCTAGTGGGAGGTGAGTGG - Intergenic
967455917 3:189686539-189686561 ATGAACTACTGGAAAGAGACAGG + Intronic
967636283 3:191805890-191805912 ATGGCCTGGTGGGAGGTGATTGG - Intergenic
968548945 4:1212728-1212750 AGGGCCTCTTGGAAGGAGCCTGG - Intronic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969319814 4:6404898-6404920 ATGGCACAGTGGAAGGACACGGG - Intronic
969741960 4:9035020-9035042 ATGGCCTCGTGGGATGAGAAAGG - Intergenic
970106107 4:12586669-12586691 ATTGCAGAGTGGAAAGAGACTGG - Intergenic
970487595 4:16540168-16540190 GGGGCCTGGTGGAAGGTGACTGG - Intronic
971545347 4:27879237-27879259 AGGGCCTGGTGGAAGGTGATTGG - Intergenic
971707706 4:30068338-30068360 ATGGCATGGGGGAAGGAGAGGGG + Intergenic
973752533 4:54036562-54036584 AGGGCCTCGTGGAAGGTGATTGG - Intronic
974573823 4:63689925-63689947 GGGGCCTAGTGGAAGGTGACTGG + Intergenic
975019891 4:69473741-69473763 GTGGCCTGGTGGGAGGTGACTGG - Intergenic
975627122 4:76360993-76361015 GGGGCCTTGTGGAAGGTGACTGG + Intronic
976186735 4:82449632-82449654 GAGGCCTAGTGGGAGGTGACTGG - Intronic
976469907 4:85416588-85416610 ATGGCCTAGTGTAAGGTAATAGG + Intergenic
976796546 4:88940175-88940197 ACTGGGTAGTGGAAGGAGACTGG + Intronic
977034155 4:91928164-91928186 AGGGTCTAGTGGGAGGTGACTGG + Intergenic
977195987 4:94060596-94060618 GTGGCATAGTGGAAAGAGCCTGG - Intergenic
977515607 4:98017753-98017775 AGGACCTGGTGGGAGGAGACTGG + Intronic
977884826 4:102243092-102243114 AGGACCTAGTGGAAGGGGAGGGG - Intergenic
978446644 4:108786872-108786894 AAGGCCCTGTGGGAGGAGACTGG - Intergenic
979452593 4:120890377-120890399 AGGGCCTAGTGGGAGGTGATTGG - Intronic
980552988 4:134364672-134364694 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
980779796 4:137480759-137480781 ATGGCCTATTGTAAGGAAATAGG + Intergenic
981062469 4:140439797-140439819 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
981239975 4:142465708-142465730 GAGGCCTAGTGGAAGGTGACCGG + Intronic
981342380 4:143636365-143636387 ATGGTCAAGCTGAAGGAGACAGG + Intronic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
982090882 4:151879058-151879080 ATGGCCAGGGGGAAGGGGACTGG + Intergenic
982093642 4:151900586-151900608 ATGGCCCAGTGGCAGTAGGCTGG + Intergenic
982532365 4:156561062-156561084 GGGGCCTTGTGGAAGGTGACTGG - Intergenic
985099484 4:186443751-186443773 GTCGCCTAGTAGAAGGAGCCTGG - Intronic
985195925 4:187429204-187429226 AGGGCCTGGTGGAAGGAGTGTGG - Intergenic
985310097 4:188588519-188588541 ATGGTCTAATGGAAATAGACAGG + Intergenic
985368735 4:189261980-189262002 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
985402507 4:189606595-189606617 AGGGGCGAGAGGAAGGAGACAGG - Intergenic
986109883 5:4704288-4704310 AAGGCCTACTGGCAGGAGAATGG + Intergenic
986482917 5:8206752-8206774 GGGGCCTAGTGGGAGGCGACTGG + Intergenic
986582478 5:9279620-9279642 GGGGCCTAGTGGAAGGTGATTGG + Intronic
986754769 5:10824674-10824696 ATGGCCAAGTAGATGGAGCCAGG - Intergenic
987971768 5:24955517-24955539 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
989154165 5:38328319-38328341 AGGGCCTGGTGGAAGGTGACTGG - Intronic
989744915 5:44817622-44817644 AGGGCCTTTTGGAAGGTGACTGG + Intronic
990095509 5:52107413-52107435 AGGGCCTGGTGGAAGGTGACTGG - Intergenic
990140258 5:52694951-52694973 AGAGCCTAGTGAAAGGAGAAAGG - Intergenic
991640152 5:68743830-68743852 ATGGCATGGAGGAAGGAGCCAGG + Intergenic
992015193 5:72568164-72568186 GTGGCCTGGTGGGAGGGGACTGG - Intergenic
992205388 5:74425964-74425986 TTGGCTTAGTGGATGGAGATGGG - Intergenic
993308315 5:86296749-86296771 ATGGACTGTTTGAAGGAGACAGG - Intergenic
994750630 5:103733205-103733227 ATGGCCTAGGGGAAGGCTATTGG + Intergenic
995358987 5:111271539-111271561 ATTGGCTAGTGGGAGGAGATGGG + Intronic
995375618 5:111471303-111471325 ATGGCCTAATTGAAGAGGACTGG - Intronic
995634349 5:114168934-114168956 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
997931885 5:138079148-138079170 GTGGCCTAGAGGGAGGACACTGG + Intergenic
999504550 5:152181296-152181318 AAGACCTGGTGGGAGGAGACTGG - Intergenic
1000646839 5:163769693-163769715 GCGGCCTGGTGGAAGGTGACTGG - Intergenic
1001651942 5:173322039-173322061 ATAACCAAGTGGAAAGAGACAGG + Intronic
1002623526 5:180507961-180507983 GGGGCCTAGTGGGAGGTGACTGG - Intronic
1002702887 5:181138419-181138441 CCGGCCTAGGGGAAGGAGACGGG - Intergenic
1004834963 6:19520577-19520599 ATGCCCTTGTGGAAGGAGTAAGG + Intergenic
1005669960 6:28095409-28095431 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1006067986 6:31476176-31476198 ATGGTCTAGTCCAACGAGACTGG + Intergenic
1006099952 6:31680421-31680443 TTGGCCAAGAGGAAGGAGAGAGG + Intronic
1007094282 6:39203812-39203834 CTGCCCTAGTGGAAGCTGACAGG + Intronic
1007822712 6:44572695-44572717 CTGGCCTGGAGGCAGGAGACTGG - Intergenic
1008397709 6:51027964-51027986 AGGGCCTACTTGAAGGAGAGTGG - Intergenic
1008471231 6:51887487-51887509 AGGGCCTGGTGGGAGGTGACTGG + Intronic
1008885737 6:56430388-56430410 AAGGCCCTGTGGGAGGAGACTGG - Intergenic
1009193718 6:60660353-60660375 ATGGCCTCATGGAATGAGAAAGG + Intergenic
1010259573 6:73799684-73799706 AAGGCCCAGTGGGAGGTGACTGG - Intronic
1010360508 6:74987562-74987584 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1011156975 6:84343937-84343959 AGGGCCTGGTGGAAGGTGATTGG + Intergenic
1012224711 6:96690458-96690480 GGGGCCTAGTGGGAGGTGACTGG + Intergenic
1013063866 6:106663660-106663682 GGGGCCTAGTGGAAGGCAACTGG - Intronic
1013297177 6:108768099-108768121 TTGGCCTTGTGGAAGGAGAGTGG + Intergenic
1013988909 6:116230133-116230155 ATGGCCTAGTGGAAAGGGAGAGG - Intronic
1014898847 6:126938603-126938625 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1014930177 6:127326157-127326179 GGGGCCTGGTGGAAGGTGACTGG + Intronic
1016878624 6:148888313-148888335 GTGGCCTGGTGGGAGGTGACTGG - Intronic
1017529975 6:155280244-155280266 CTGGCCCAGTGGAAGGAGCTTGG - Intronic
1017707925 6:157140931-157140953 ATGTCCTGGTGGCAGGAAACAGG - Intronic
1018067041 6:160131580-160131602 GTGGCCTAGTGGAGGCAGATGGG + Intronic
1018094150 6:160370326-160370348 ATGTCCTTGAGGAGGGAGACTGG - Intronic
1018378623 6:163237016-163237038 GGGGCCTAGTGGAAGGTGATTGG - Intronic
1018416043 6:163602986-163603008 ATGACCCAGTGGAAGGAAACGGG + Intergenic
1019706487 7:2499440-2499462 AGGGCCCTGTGGAAGGAGCCAGG + Intergenic
1021559734 7:21957866-21957888 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1021613061 7:22476361-22476383 ATGGCCCAGTGGCAGCAGGCTGG + Intronic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1022650196 7:32267182-32267204 AAGGCTGAGTGCAAGGAGACCGG + Intronic
1022990710 7:35704522-35704544 ATGGAACAGTGGAAGGAGAAGGG - Intergenic
1023763570 7:43489597-43489619 ATGGCCTACTTGAAGGACAAGGG - Intronic
1024115292 7:46187148-46187170 GGGGCCTAGTGGGAGGTGACTGG - Intergenic
1024356552 7:48419167-48419189 AGGGCCTGGTGGGAGGTGACTGG - Intronic
1024461280 7:49662088-49662110 ATGGTTCAGAGGAAGGAGACAGG - Intergenic
1026490821 7:70861842-70861864 GTGACCCAGTGGAAGGGGACTGG - Intergenic
1027686973 7:81290254-81290276 AAGGCCTGGTGGGAGGACACTGG - Intergenic
1027696045 7:81411830-81411852 GTGGCCTGGTGGAAGGTGACTGG - Intergenic
1028792274 7:94866558-94866580 AGGGCCTGGTGGAAGGTGATTGG + Intergenic
1029120180 7:98262587-98262609 ATGGCCCAGTGGGAGGTGTCTGG - Intronic
1030502425 7:110376587-110376609 AGGGCCTAGTGGGAGGTGATTGG - Intergenic
1032282456 7:130515445-130515467 AGGGCCTAGTGGGAGGTGACTGG - Intronic
1032894487 7:136235619-136235641 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1033159797 7:138985124-138985146 ATGTTCTAGTGAGAGGAGACAGG + Intergenic
1033501884 7:141959440-141959462 ATCGCCTAGTTGGAGGAGAGAGG - Intronic
1034206676 7:149322186-149322208 GGGGCCTAGTGGGAGGCGACTGG - Intergenic
1034679734 7:152919512-152919534 ATGACCCAGTGGAAGGAACCAGG - Intergenic
1034729009 7:153367115-153367137 AGGGCCTGGTGGAAGATGACTGG - Intergenic
1035199636 7:157253492-157253514 ATGGCATTGTGGAAGCACACAGG + Intronic
1035891374 8:3347259-3347281 ATGGCCTAGGGGTTGGAGAATGG - Intronic
1037065444 8:14571255-14571277 GTGACCTGGTGGAAGGTGACTGG - Intronic
1037175654 8:15943652-15943674 ATGGCCTGGTGGGAGGTGATTGG + Intergenic
1037204718 8:16302717-16302739 GGGGCCTAGTGGGAGGTGACTGG + Intronic
1037344050 8:17879450-17879472 AAGGCCTAGTGGGAGGCGATTGG + Intronic
1037886696 8:22599512-22599534 GTGGCCTAGGGGGAGGAGAGAGG - Intronic
1038436670 8:27541266-27541288 AAGGCCTTGTGCAAGGACACAGG - Intronic
1038599705 8:28927632-28927654 GGGGCCTAGTGGAAGGTGTCTGG - Intronic
1038840563 8:31180901-31180923 ATGGTCTAGAGGATGGAGACAGG - Intergenic
1040427580 8:47304254-47304276 GGGGCCTGGTGGAAGGTGACTGG + Intronic
1041373326 8:57187891-57187913 AGGGGCTAGAGGTAGGAGACAGG + Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1042861305 8:73316929-73316951 ATGGCCTGGTGGGAGGTGACTGG - Intronic
1042985199 8:74575619-74575641 GAGGCCTAGTGGGAGGTGACTGG - Intergenic
1043354561 8:79397195-79397217 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1044102897 8:88162653-88162675 GGGGCCTGGTGGAAGGTGACTGG + Intronic
1045194023 8:99911830-99911852 GGGGCCTAGTGGGAGGAGTCTGG - Intergenic
1045730117 8:105228229-105228251 ATGTCCAAGTGGGAGGAGAGTGG + Intronic
1045950762 8:107849213-107849235 ATGGCCTAGTGGCAGTTGGCTGG - Intergenic
1047330950 8:123886280-123886302 GTGGCCTAGTGGAAGGTGTTTGG + Intronic
1047574497 8:126137866-126137888 AGGGCCTTGTGGGAGGTGACTGG - Intergenic
1047718538 8:127617933-127617955 ATGGCCTGGAGGAGGGGGACAGG + Intergenic
1047888711 8:129282662-129282684 ATTGCCTAGAGGAAGGGTACTGG - Intergenic
1047974188 8:130113052-130113074 ATGGACTGGAGGAAGGAAACTGG - Intronic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1048860698 8:138722769-138722791 CTGGTGTAGTGGAAGGAGCCTGG - Intronic
1049319032 8:141986158-141986180 ATGGTCTACTGCAAGGAGATAGG + Intergenic
1049328728 8:142038543-142038565 ATGGACTGGAGGAAGGAGTCAGG - Intergenic
1049508929 8:143018272-143018294 AGGGCCGGGTGGAAGGAGGCCGG + Intronic
1049875010 8:145011733-145011755 AAGGCCCTGTGGGAGGAGACTGG + Intergenic
1053536876 9:38935132-38935154 ATGGCTGAATGGAGGGAGACAGG + Intergenic
1054629260 9:67428798-67428820 ATGGCTGAATGGAGGGAGACAGG - Intergenic
1055366612 9:75550776-75550798 GGGGCCTGGTGGAAGGTGACTGG + Intergenic
1056772989 9:89492997-89493019 ATGGTCAAGTGGAGGGAGATGGG - Intronic
1057301643 9:93889292-93889314 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1057490211 9:95514971-95514993 ATAGCCTTGTGGAAGGAAGCTGG + Intronic
1058066066 9:100549362-100549384 GGGGCCTTGTGGAAGGTGACTGG - Intronic
1058388843 9:104471138-104471160 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1058783927 9:108366977-108366999 AGGGCCTGGTGGAAGGTGATTGG + Intergenic
1059287537 9:113188046-113188068 ATGAGCCAGTGGAAGGAAACTGG + Intronic
1060030126 9:120207505-120207527 AGGACCTACTGGAAGGTGACGGG + Intergenic
1060869697 9:127029754-127029776 AAGGCCTTGGGAAAGGAGACTGG - Intronic
1061003327 9:127914974-127914996 AAGGCCCAGTGGATGGAGACTGG - Intronic
1061255342 9:129451919-129451941 ATGGCCCAGGGGCAGGAGCCAGG + Intergenic
1185760235 X:2684990-2685012 GGGGCCTGGTGGAAGGTGACTGG - Intergenic
1186103371 X:6180268-6180290 GGGGCCTGGTGGGAGGAGACTGG + Intronic
1186173944 X:6905608-6905630 GGGACCTAGTGGAAGGTGACTGG - Intergenic
1186502040 X:10059188-10059210 ATTACCAAGTGGAAGGAGACAGG - Intronic
1187634261 X:21209965-21209987 AAGACCTGGTGGAAGGTGACTGG + Intergenic
1187873530 X:23783750-23783772 ATGGCCTTGGCGAAGGTGACAGG - Intronic
1188022231 X:25171597-25171619 ATAGCCTAGAGGAAGAAGAGAGG + Intergenic
1188558781 X:31443947-31443969 GAGGCCTAGTGGAAGGTGTCTGG + Intronic
1189050553 X:37640883-37640905 TATGCCTAGTGGAAGGAGAAAGG - Intronic
1191255905 X:58279551-58279573 ATCGCCTAGGGGACAGAGACAGG - Intergenic
1193277918 X:79612054-79612076 GTGGCCTGGTGGAAGGTGATTGG - Intergenic
1194048173 X:89034932-89034954 GTGGCCTAGTGGGAGGTGATTGG - Intergenic
1194423965 X:93713859-93713881 AGGGCCTAGTGGGAGGTGATTGG - Intergenic
1194619383 X:96150447-96150469 AGGGACTAGTGGGAGGTGACTGG - Intergenic
1194855265 X:98919555-98919577 AGGGCCTGGTGGGAGGTGACTGG + Intergenic
1194935084 X:99938989-99939011 AAGGCCCTGTGGGAGGAGACTGG - Intergenic
1195921411 X:109987559-109987581 ATGGAGAAATGGAAGGAGACAGG + Intergenic
1196489371 X:116248773-116248795 AGGAGCTAGTGGAAGGAGAGGGG - Intergenic
1196789586 X:119451936-119451958 ATGTCCTAGTGGAAGGAGCCAGG - Intronic
1197091338 X:122541443-122541465 ATGTCATATTGGAAGGACACTGG - Intergenic
1199188702 X:144945483-144945505 AGGGCCTGGTGGGAGGTGACTGG - Intergenic
1199595922 X:149505622-149505644 AAGGCCTCATGGAAGGAGAATGG - Intronic
1199803401 X:151273295-151273317 CTGTCCCAGTGGAGGGAGACAGG + Intergenic
1200758775 Y:7016743-7016765 ATGGCCTAGTGCCAGCAGGCAGG - Intronic