ID: 1114192746

View in Genome Browser
Species Human (GRCh38)
Location 14:20452734-20452756
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1909
Summary {0: 5, 1: 18, 2: 116, 3: 411, 4: 1359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114192744_1114192746 15 Left 1114192744 14:20452696-20452718 CCCTTTCGTGATCTTTTTTTTTT 0: 1
1: 0
2: 57
3: 743
4: 7304
Right 1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG 0: 5
1: 18
2: 116
3: 411
4: 1359
1114192745_1114192746 14 Left 1114192745 14:20452697-20452719 CCTTTCGTGATCTTTTTTTTTTT 0: 1
1: 3
2: 87
3: 1310
4: 11507
Right 1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG 0: 5
1: 18
2: 116
3: 411
4: 1359
1114192743_1114192746 22 Left 1114192743 14:20452689-20452711 CCTCATACCCTTTCGTGATCTTT 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG 0: 5
1: 18
2: 116
3: 411
4: 1359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900292913 1:1931709-1931731 GAGTCTTTGCTCTGTCACCCAGG - Intronic
900359747 1:2282849-2282871 CAGCCTCCGACCTGTCACCCCGG + Intronic
900488300 1:2933905-2933927 CAGGCACAGATGTGTCACCCCGG - Intergenic
900855142 1:5175565-5175587 CAGACTCTCCTCTGTCGCCCGGG + Intergenic
900868350 1:5284397-5284419 AAGTCTCACTCCTGTCACCCAGG - Intergenic
900968854 1:5978187-5978209 CAGTCTCTGGGCTGCCACCCAGG + Intronic
901046098 1:6396592-6396614 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
901080941 1:6583803-6583825 GAGTCTCCCCTCTGTCGCCCAGG + Intronic
901092011 1:6648179-6648201 GAGTCTCGGCTCTGTCGCCCAGG + Intronic
901268081 1:7927639-7927661 GGGTCTCTGCTTTGTCACCCAGG - Intronic
901287588 1:8093432-8093454 CAGAGTCTGCTCTGTCACTCAGG - Intergenic
901408101 1:9063719-9063741 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
901484693 1:9550696-9550718 GAGTCTTGGCTTTGTCACCCAGG + Intronic
901640738 1:10691886-10691908 CAGTCAGAACTCTGCCACCCTGG + Intronic
901648737 1:10730490-10730512 CACTCTCAGCTCAGTCACACGGG - Intronic
901675896 1:10884669-10884691 CAGAATCTGCTCTGTCGCCCAGG + Intergenic
901846386 1:11985490-11985512 GAGACTTCGCTCTGTCACCCAGG + Intronic
901846656 1:11987283-11987305 GAGTCTCACTTTTGTCACCCAGG - Intronic
901897815 1:12329550-12329572 CAGTGCCAGCCCTGGCACCCAGG - Intronic
902318780 1:15644913-15644935 CAGTCTTTGTTCTGTCGCCCAGG + Intronic
902449158 1:16485647-16485669 CAGGCCCAGCTCTGTCACTCTGG + Intergenic
902468551 1:16632353-16632375 CAGGCCCAGCTCTGTCACTCTGG + Intergenic
902505588 1:16937637-16937659 CAGGCCCAGCTCTGTCACTCTGG - Exonic
902636158 1:17736328-17736350 CAGTCCCAGCTCTGCCCCTCGGG - Intergenic
902643249 1:17780180-17780202 GGGTCTCAACTCTGTCGCCCAGG - Intronic
902665032 1:17931437-17931459 CTGGCTCTCCTCTGTCACCCTGG - Intergenic
902884814 1:19396925-19396947 CAGAGTCCTCTCTGTCACCCAGG - Intronic
903037471 1:20502524-20502546 GAGTCTTGGCTCTGTCACCCAGG - Intronic
903048453 1:20583009-20583031 GAGTCTCAACTCTGTCACCCAGG + Intergenic
903077427 1:20782556-20782578 CAGGCTCTGCTCTGTCACCTAGG - Intronic
903154576 1:21435294-21435316 CAGGCCCAGCTCTGTCACTCTGG - Intergenic
903513490 1:23894092-23894114 CAGGGTCTGCTCTGTCACTCAGG - Intronic
903636489 1:24821577-24821599 CACTCCTTGCTCTGTCACCCAGG + Intronic
903714452 1:25354015-25354037 CAGGGTCTGCTCTGTCACCCAGG + Intronic
903811443 1:26036961-26036983 CAATCACAGCTGTGACACCCAGG + Intergenic
903841384 1:26243965-26243987 CGGAGTCTGCTCTGTCACCCAGG - Intronic
903909032 1:26708718-26708740 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
904066440 1:27755598-27755620 GGGTCTCAGCTGTGTCACCCTGG + Intronic
904118888 1:28182704-28182726 GAGTCTCACTTTTGTCACCCAGG + Intronic
904137812 1:28327674-28327696 CACTGCCAGCTCTGTCTCCCAGG + Intergenic
904151241 1:28443305-28443327 TCGTCTCAACTCTGTCACCGAGG + Intronic
904238165 1:29127179-29127201 CAGAGTCCGCTCTGTCACCCAGG - Intergenic
904496582 1:30890719-30890741 CAGGCTCTGCTGTGTGACCCTGG - Intronic
904556767 1:31370239-31370261 CAATCTCAGATTTGTGACCCTGG - Intronic
904599803 1:31667183-31667205 GAGTCTCAGCTTTGTCACTCTGG + Intronic
904700112 1:32352859-32352881 GGGTCTCAACTCTGGCACCCAGG + Intronic
904703518 1:32373545-32373567 GGGTCTCAGCTCTGTCACCCAGG + Intronic
904718606 1:32488820-32488842 GAGTTTCATCTTTGTCACCCAGG + Exonic
904727744 1:32562600-32562622 GAGTCTTCGCTCTGTCACCCAGG + Intronic
905134009 1:35784282-35784304 CAGGATCTCCTCTGTCACCCAGG - Intergenic
905139848 1:35834719-35834741 GAATCTCAGCTCTGTCACCCAGG + Intronic
905178292 1:36151583-36151605 AGGTTTCAGTTCTGTCACCCAGG - Intronic
905556242 1:38887239-38887261 GGGTCTCAACTCTGTCGCCCAGG + Intronic
905556455 1:38889117-38889139 GAGTCTCAACTCTGTCGCCCAGG + Intronic
905676319 1:39827843-39827865 GAGTCTCAACTCTGTCACCCAGG - Intergenic
905756299 1:40512625-40512647 GAGTCTTCACTCTGTCACCCAGG + Intronic
905757581 1:40524039-40524061 GAGTCTTCGCTCTGCCACCCAGG + Intergenic
905788668 1:40778330-40778352 CAGTTCTTGCTCTGTCACCCAGG - Intergenic
906060555 1:42945712-42945734 CAGAGTCTGCTCTGTCGCCCAGG - Intronic
906112409 1:43332817-43332839 GAGTCTTAACTCTGTCGCCCAGG - Intergenic
906165357 1:43681992-43682014 AAGTCTCACTTCTGTCACCCAGG + Intronic
906218923 1:44061890-44061912 CAGAGTTTGCTCTGTCACCCAGG - Intergenic
906392031 1:45426123-45426145 AAGTCTCAGCTCTGTCACCTAGG - Intronic
906482007 1:46205230-46205252 AGCTCTGAGCTCTGTCACCCAGG - Intronic
906968971 1:50490353-50490375 GAGTCTTCGCTCTGTCACCCAGG - Intronic
907056003 1:51368621-51368643 GAGTCTCGCCTGTGTCACCCAGG + Intronic
907068598 1:51512873-51512895 GGGTCTTAGCTCTGTCACCTAGG + Intronic
907146972 1:52243731-52243753 GGGTCTCAGCTCTGTCACTCTGG - Intronic
907215952 1:52864204-52864226 TAGTCTCAGCTCTGTTGCCCAGG + Intronic
907221767 1:52912231-52912253 GGGTCTCAACTCTGTCACCCAGG + Intronic
907346414 1:53784930-53784952 GAGTCTCTGCTCTGTTGCCCAGG - Intronic
907682119 1:56574172-56574194 CAGAGTCTTCTCTGTCACCCAGG - Intronic
907685225 1:56604688-56604710 CAGGGTCTGCTCTGTCACCCAGG + Intronic
908104190 1:60824545-60824567 CAGTGCTTGCTCTGTCACCCAGG - Intergenic
908198267 1:61767511-61767533 AGGTCTTGGCTCTGTCACCCAGG - Intronic
908705928 1:66954730-66954752 GAGTCTCAACTCTGTCACCCAGG + Intronic
908723149 1:67147676-67147698 CAGAGTCTGCTCTGTCGCCCAGG - Intronic
908777090 1:67650591-67650613 CAGGGTCTGCTCTGTCACCCAGG - Intergenic
908798084 1:67851458-67851480 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
909701771 1:78532589-78532611 GAGTCTCAACTCTGTTACCCAGG + Intronic
910155807 1:84217765-84217787 GGGTCTCAGCTCTGTAGCCCAGG - Intronic
910182155 1:84496895-84496917 GAGTCTCAGCTTTGTTGCCCAGG + Intronic
910194131 1:84623021-84623043 CAGTCTTACCAGTGTCACCCAGG - Intergenic
910219235 1:84873776-84873798 GAGTCTCTGCTCTGTCACCCAGG + Intronic
910655442 1:89613954-89613976 GAGTCTCACTCCTGTCACCCAGG + Intergenic
910843261 1:91581851-91581873 CATTCTCAGCTTTGTCACAAGGG + Intergenic
910989114 1:93036708-93036730 CAGAGTCCACTCTGTCACCCAGG - Intergenic
911085667 1:93975414-93975436 AAGTCTCAGCTCTGTCACCCAGG + Intergenic
911533385 1:99072787-99072809 CTCGCTCTGCTCTGTCACCCAGG + Intergenic
911604956 1:99894160-99894182 CAGGGTCTCCTCTGTCACCCAGG - Intronic
911724986 1:101233701-101233723 CTGGCTCTGCTCTGTCATCCAGG - Intergenic
911729695 1:101280027-101280049 CAAGCTCTCCTCTGTCACCCAGG - Intergenic
912282914 1:108335740-108335762 CAATCTCAGCTCCATCTCCCGGG - Intergenic
912357604 1:109068017-109068039 CAGTCTTGGCTCTGTCGCCCAGG + Intronic
912546399 1:110454527-110454549 CAGTCCCAGCTCTGTCTCATTGG - Intronic
912674942 1:111670446-111670468 GAGTCTCAACTCTGTCACCCAGG - Intronic
912771622 1:112469638-112469660 GAGACGGAGCTCTGTCACCCAGG + Intronic
912808835 1:112778079-112778101 CGCTCTTCGCTCTGTCACCCAGG - Intergenic
912836015 1:112997119-112997141 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
913038946 1:115004567-115004589 GAGTCTCACTCCTGTCACCCAGG + Intergenic
913134141 1:115871468-115871490 GAGTCTTTGCTCTGTCGCCCAGG - Intergenic
913722126 1:121607391-121607413 TTGTCTCAGCTATGTCACCTGGG + Intergenic
913741911 1:121854971-121854993 TTGTCTCAGCTATGTCACCTGGG + Intergenic
914724521 1:150316519-150316541 CAGAGTCTGCTCAGTCACCCAGG - Intergenic
914731779 1:150377520-150377542 CACTGCCAGCTCTGTCTCCCAGG - Intronic
914770480 1:150679772-150679794 CAGTCTCCACTCTGTCGTCCAGG - Intronic
914775681 1:150732632-150732654 GAGTCTCCACTCTGTCATCCAGG + Exonic
914843708 1:151268574-151268596 AAGTCTGTGCTCTGTCACCCAGG + Intergenic
914897284 1:151687919-151687941 CAGACTCCGCTCTGTCGCCCAGG - Intronic
915055887 1:153130118-153130140 CAGTCTCAGCTCTTTCTTCATGG + Intergenic
915277385 1:154798940-154798962 CAGAGTCCACTCTGTCACCCAGG + Intronic
915518263 1:156426433-156426455 CTTTCTCACCTCTGTCACCCAGG + Intronic
915570378 1:156742219-156742241 CAGTCTCGTCTCTTTTACCCTGG - Intronic
915576240 1:156779914-156779936 CAGAGTCTGCTCTGTTACCCAGG + Intronic
915581202 1:156814340-156814362 CAGCCTCGCCTCTGTCTCCCCGG + Intronic
915756464 1:158265600-158265622 GAGTCTCACTTCTGTCACCCAGG - Intergenic
915961704 1:160272449-160272471 CAGTCTCGCTCCTGTCACCCAGG - Intergenic
916036018 1:160923095-160923117 AAGTCTCATCTCTGTCACCCAGG + Intergenic
916082504 1:161243792-161243814 CTTTCACAGCTCTGTCACCCAGG + Intergenic
916098297 1:161371274-161371296 CAGTCCTCCCTCTGTCACCCAGG + Exonic
916408460 1:164521074-164521096 CAGTCTCAACTCTGTCACCCAGG - Intergenic
916476001 1:165169589-165169611 GAGTCTTAACTCTGTCACCCAGG + Intergenic
916541769 1:165763642-165763664 GGGTCTCAACTCTGTCACCTAGG + Intronic
916666167 1:166969528-166969550 CAGTTTCTGCTCTGTCACTGGGG + Intronic
916738231 1:167627389-167627411 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
916746601 1:167689610-167689632 CAGTCATACCTCTGTCATCCTGG + Intronic
916812934 1:168321480-168321502 CAGCCTGGGCTCTGTCACCCAGG + Intergenic
916891346 1:169115157-169115179 GAGTCTTCGCTCTGTCACCCAGG - Intronic
916962276 1:169901276-169901298 GAGTCCAGGCTCTGTCACCCAGG + Intergenic
917102651 1:171461385-171461407 CGGTCTTCACTCTGTCACCCAGG - Intergenic
917774720 1:178321107-178321129 GAGTCTCATCTCTGTCACCCAGG + Intronic
917814534 1:178694096-178694118 CAGTTTCCCCTCTGTCTCCCAGG + Intergenic
917863897 1:179174867-179174889 GAGTCTCTGCTCTGTCACCCAGG - Intronic
917873183 1:179260405-179260427 GAGTCTTTGCTTTGTCACCCAGG - Intergenic
917950098 1:180023244-180023266 TAGGGTCAGCTTTGTCACCCAGG - Intronic
918043459 1:180927141-180927163 CACTCACATCTCTGTCACCCAGG + Intronic
918052459 1:180986567-180986589 CAGGGTCTCCTCTGTCACCCAGG + Intronic
918176200 1:182047650-182047672 GAGTCTTAACTCTGTCACCCAGG - Intergenic
918197322 1:182234601-182234623 TATTCTCAGCTCTTTTACCCAGG - Intergenic
918240255 1:182614642-182614664 GAGCCTCCGCTCTGTCGCCCAGG - Intergenic
918538822 1:185605037-185605059 GGGTCTCACTTCTGTCACCCAGG - Intergenic
918882882 1:190148567-190148589 GAGTCTCAACTCTGTCGCCCTGG - Intronic
919104050 1:193127245-193127267 GAGTCTTTGCTCTATCACCCAGG - Intronic
919524945 1:198635390-198635412 CAGTCTCAGCTCTGTCGCCCAGG - Intergenic
919533128 1:198750755-198750777 CAGTCTTACCCCTTTCACCCTGG + Intronic
919577297 1:199326733-199326755 GAGTTTTTGCTCTGTCACCCAGG - Intergenic
919596435 1:199569019-199569041 GGGTCTTAACTCTGTCACCCAGG - Intergenic
919657435 1:200211714-200211736 CAGGGTCTGCTCTGTCATCCAGG + Intergenic
919721609 1:200842947-200842969 GTGTCTCATCTCTGTCACCCAGG - Intronic
919768555 1:201142719-201142741 CACTCTGAGCTCTGTCCCCAGGG - Intronic
919841480 1:201612426-201612448 GAGTCGCAGCTCTGTCACCCAGG - Intergenic
919950231 1:202356153-202356175 CTTGCTCTGCTCTGTCACCCAGG - Intronic
920247631 1:204600354-204600376 CAGTCTCAGCTGTGTGACCGTGG + Intergenic
920277442 1:204817500-204817522 GAGTTTTAGCTCTGTCACCCAGG + Intergenic
920407320 1:205726171-205726193 CAGTCTCACTCTTGTCACCCAGG - Intronic
920407379 1:205726987-205727009 CAGTCCTGGCTCTGTCACCTAGG + Intronic
920408179 1:205735966-205735988 CAGGGTCTGCTCTGTCATCCAGG + Intronic
920513911 1:206570115-206570137 GAGTCTCAAATCTGTCACCCAGG + Intronic
920537985 1:206752860-206752882 GCGTCTTGGCTCTGTCACCCAGG + Intergenic
920811765 1:209292584-209292606 AAGTCTCAGTTATGTCTCCCAGG + Intergenic
921136610 1:212266423-212266445 CAGTGTCTGCTGTGTCGCCCAGG + Intergenic
921269066 1:213450947-213450969 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
921300311 1:213745598-213745620 CAGCCCCACCTCTGTCCCCCAGG + Intergenic
921555299 1:216591596-216591618 CAGTGTCAGCCATGTCTCCCAGG - Intronic
921972800 1:221168864-221168886 CAGTGTCTGCTGTGTCACCCAGG + Intergenic
922081160 1:222298241-222298263 GAGTCTCACCCTTGTCACCCAGG - Intergenic
922254701 1:223883849-223883871 CAATCTCAGCTCTGCCTCCCGGG + Intergenic
922254864 1:223885107-223885129 CAGTGCAAGCTCTGTCTCCCGGG - Intergenic
922433268 1:225577089-225577111 GGGTCTTAACTCTGTCACCCAGG - Intronic
922435331 1:225599768-225599790 GAGTCTCGGCCCTGTCGCCCAGG - Intronic
922485057 1:225967624-225967646 GAGTCTCAACTCTGTTGCCCAGG - Intergenic
922501778 1:226102285-226102307 CAGTCTCACTCTTGTCACCCAGG - Intergenic
922727703 1:227930971-227930993 GAGTCTCACCCTTGTCACCCAGG - Intronic
922931239 1:229391273-229391295 CAGCGTCTACTCTGTCACCCAGG + Intergenic
922938806 1:229443051-229443073 GGGTCTCCACTCTGTCACCCAGG + Intronic
923022316 1:230174647-230174669 CTGTCTCCGCTCTGTCCCTCCGG + Intronic
923227157 1:231948893-231948915 GAGTCTCAACTCTGTTGCCCAGG + Intronic
923556339 1:235003546-235003568 CAGGTTTTGCTCTGTCACCCAGG - Intergenic
923632901 1:235665584-235665606 GAGTCTCTGCTCTGTCGCCCAGG - Intronic
923646397 1:235824992-235825014 GAGTCTCAACTCTGTCGCCCAGG - Intronic
923754800 1:236782450-236782472 GCGTCTCTCCTCTGTCACCCAGG + Intergenic
923764457 1:236880133-236880155 GAGACGGAGCTCTGTCACCCAGG - Intronic
923774044 1:236962308-236962330 GAGGGTCTGCTCTGTCACCCAGG - Intergenic
924101052 1:240603045-240603067 CTGTCGCAGCTCTGTCACCCAGG - Intronic
924270587 1:242328047-242328069 CAGGGTCTCCTCTGTCACCCAGG - Intronic
924335057 1:242979252-242979274 GAGTCTTAACTCTGTCACCTAGG - Intergenic
924381381 1:243468241-243468263 CGGAGTCAGCTGTGTCACCCAGG + Intronic
924741506 1:246796782-246796804 CAGGGTCTGCTCTGTCACCCGGG - Intergenic
924761955 1:246995785-246995807 GAGTCTCAGCTCTGTCACCCAGG - Intronic
1062828786 10:591146-591168 GAGTCTCTGCTCTGTCACCCAGG + Intronic
1062993666 10:1845208-1845230 CAGTCTCTGCGCTGACACTCAGG - Intergenic
1063832268 10:9967463-9967485 CAGAGTCTGCTCTGTCGCCCAGG + Intergenic
1063879004 10:10511384-10511406 GAGTCTTAACTCTGTCACCCAGG - Intergenic
1063912934 10:10850829-10850851 GAGTCTCTGCTCTGTCACCCAGG + Intergenic
1063966489 10:11350175-11350197 GAGACTTTGCTCTGTCACCCAGG + Intergenic
1064080609 10:12304943-12304965 CAGTCTCATCTCAGACACCTGGG + Intergenic
1064153501 10:12885014-12885036 AAGGTCCAGCTCTGTCACCCAGG + Intergenic
1064219036 10:13424153-13424175 CGGTCTCAGCTCTGCCTCCTGGG + Intergenic
1064292882 10:14051677-14051699 CAGTCTCACCTCTCTCTCCCAGG - Intronic
1064348536 10:14555744-14555766 CAGTCCTTGCTCTGCCACCCAGG + Intronic
1064424391 10:15217661-15217683 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1064762904 10:18639466-18639488 GAGTCTCAAGTCTGTCACCCCGG - Intronic
1065362601 10:24903178-24903200 CAGTTTCACTCCTGTCACCCAGG - Intronic
1065454790 10:25895518-25895540 CAGAGTCTGCTCTGTCACCCAGG - Intergenic
1065553169 10:26888990-26889012 GAGTCTCACTTCTGTCACCCAGG - Intergenic
1065567500 10:27028519-27028541 CGATCTCAGCTCTGCCTCCCGGG - Intronic
1065763281 10:29003347-29003369 CAGAGTCTGCTCTGTCGCCCAGG + Intergenic
1065839293 10:29687645-29687667 GAGTCTCAACTCTGTCACCCAGG - Intronic
1065883051 10:30053531-30053553 GAGTATCCGCTCTGTCACCCAGG - Intronic
1065905035 10:30242910-30242932 GAGTTTTTGCTCTGTCACCCAGG - Intergenic
1066093377 10:32048892-32048914 GGGTCTCGGTTCTGTCACCCAGG + Intronic
1066198744 10:33126610-33126632 AGGTCTCAGCTCTGTTATCCAGG + Intergenic
1066231794 10:33442079-33442101 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1066308557 10:34171922-34171944 GAGTCTCATCTCTGTCACCCAGG - Intronic
1066402072 10:35086322-35086344 CTCTCTTAGTTCTGTCACCCAGG + Intronic
1066493545 10:35918511-35918533 GAGTCTCACTTCTGTTACCCAGG + Intergenic
1066630737 10:37457045-37457067 GAGTCTCTGCTCTGTCACCCAGG - Intergenic
1066714360 10:38270747-38270769 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
1067110749 10:43398051-43398073 CAGTTTTCACTCTGTCACCCAGG + Intronic
1067114660 10:43425862-43425884 CAGTCTCACTTCTGCCAGCCAGG + Intergenic
1067856984 10:49803054-49803076 CAGAGTCTGCTCTGTCGCCCAGG + Intergenic
1067857259 10:49805498-49805520 CAGAGTCTTCTCTGTCACCCAGG + Intergenic
1068081110 10:52318359-52318381 AAGTCTCAGCTTCCTCACCCAGG + Intergenic
1068108640 10:52651980-52652002 GAGTCTCAACTGTGTCACCCAGG - Intergenic
1068771804 10:60829815-60829837 CAGGGTCTTCTCTGTCACCCAGG - Intergenic
1068869528 10:61928324-61928346 GGGTCTCAACTCTGTCACCTAGG + Intronic
1068901951 10:62279390-62279412 AAGTCTCAACTCTGTCGCCCAGG - Intergenic
1069004394 10:63301039-63301061 CAGAGTCTGCTCTGTCACCCAGG + Intronic
1069096786 10:64269061-64269083 GAGTTTCACTTCTGTCACCCAGG + Intergenic
1069451869 10:68524232-68524254 CAATCTCATCTCTGCCTCCCGGG - Intronic
1069518507 10:69099329-69099351 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1069648481 10:70023106-70023128 CAGAGTCTGCTCTGTCACCCAGG - Intergenic
1069655641 10:70086020-70086042 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1069655787 10:70087155-70087177 GGATCTCACCTCTGTCACCCAGG - Intronic
1069692330 10:70362157-70362179 GAGTCTTGGCTCTGTCACCCAGG - Intronic
1069986383 10:72286989-72287011 CTCTGTCACCTCTGTCACCCAGG - Intergenic
1070085514 10:73233364-73233386 CAGTCTCACTCCTGTCGCCCAGG + Intronic
1070200899 10:74205012-74205034 GAGTGTCAACTCTGTCACCCAGG - Intronic
1070303075 10:75219507-75219529 GAGTCTTTGCTGTGTCACCCAGG + Intronic
1070540862 10:77414230-77414252 CTGTCTCAGCTCTGTAACCCTGG + Intronic
1070732554 10:78841417-78841439 CAGTATCAACTCAGTCACACAGG - Intergenic
1070741942 10:78909001-78909023 TAGTCTTAGCTCTGTCACTCAGG + Intergenic
1070840614 10:79484899-79484921 CAGGGTTTGCTCTGTCACCCAGG + Intergenic
1070874858 10:79793500-79793522 GAGTCTCCGCTCTGTTGCCCAGG + Intergenic
1071175054 10:82916689-82916711 CAATCTCAGCTCCGCCTCCCAGG + Intronic
1071261110 10:83919799-83919821 AAGTCTCAACTCTGTTGCCCAGG - Intergenic
1071641782 10:87315666-87315688 GAGTCTCCGCTCTGTTGCCCAGG + Intergenic
1071686320 10:87761629-87761651 CAATCTCTGCTTTGTCACCCAGG - Intronic
1071839441 10:89454038-89454060 TTGTCTCAGCTCTGTTGCCCAGG + Intronic
1072084666 10:92067021-92067043 GAGTCTCGGCTGTGTCACCCAGG - Intronic
1072110274 10:92313206-92313228 GAGTCTCGGCTCTGTCGCCCAGG - Intronic
1072124090 10:92430232-92430254 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
1072177605 10:92944260-92944282 GAGTCTTTGCTCTATCACCCAGG + Intronic
1072185227 10:93031536-93031558 GAGTCTTCGCTCTGTCACCCAGG + Intronic
1072244517 10:93530897-93530919 CAGGGTCCCCTCTGTCACCCAGG + Intergenic
1072585611 10:96779122-96779144 GAGTCTCAGCTCTGTCATCCAGG + Intergenic
1072591123 10:96829747-96829769 GAGTCTCAGCTCTGTCGCCCAGG + Intergenic
1072613253 10:97033072-97033094 AAGGTCCAGCTCTGTCACCCAGG + Intronic
1072801054 10:98392741-98392763 CAGTCTCAGTTCAGTGACCAGGG + Intronic
1072876271 10:99175951-99175973 CAGCCTCTGCTGTGACACCCAGG + Intronic
1072877203 10:99185276-99185298 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1072918119 10:99552807-99552829 GGGTCTCAGCTCTGTCACCTAGG - Intergenic
1072985535 10:100136474-100136496 CTGTCTCAGCACTGTTACCATGG - Intergenic
1073005058 10:100317060-100317082 GAATCTCAGCTCTGTCACCCAGG - Intronic
1073028586 10:100506937-100506959 CAGTTCTTGCTCTGTCACCCAGG - Intronic
1073140039 10:101241212-101241234 TAGTCTCAGCTTTGCCAGCCAGG - Intergenic
1073143784 10:101265953-101265975 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
1073153029 10:101324551-101324573 GAGTCTTTGCTCTGTCGCCCAGG - Intergenic
1073233190 10:101990207-101990229 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1073283765 10:102374557-102374579 CAGGTTTTGCTCTGTCACCCAGG - Intronic
1073333892 10:102690325-102690347 CTTGCTCTGCTCTGTCACCCAGG + Intronic
1073413223 10:103359624-103359646 GAGTCTCACCTCTGTCGCCCAGG - Intergenic
1073413661 10:103363762-103363784 CAGAGTCTCCTCTGTCACCCAGG + Intergenic
1073504807 10:103975944-103975966 GAGTCTCACCTCTGTCATCCAGG + Intronic
1073586695 10:104717257-104717279 GGGTCTCCCCTCTGTCACCCAGG - Intronic
1073717286 10:106121651-106121673 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
1073768790 10:106712168-106712190 CAGTCTCAAATCTATCTCCCTGG + Intronic
1074371494 10:112904294-112904316 AAGTTTCAGCTGAGTCACCCAGG + Intergenic
1074382483 10:112992075-112992097 CATTCCCAGCCCTGTTACCCTGG + Intronic
1074385759 10:113015473-113015495 CAGGTTCAGCTCTGTCGCCCAGG + Intronic
1074752956 10:116604712-116604734 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1075035853 10:119066481-119066503 CAGTCTTAACTCTGCCCCCCAGG - Intronic
1075274620 10:121081961-121081983 CAGTCTCTGCTGTGTCAGGCTGG + Intergenic
1075376924 10:121985948-121985970 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1075693251 10:124415320-124415342 GAGTCTCAGCTATGTTGCCCAGG + Intronic
1075752825 10:124787405-124787427 GAGTCTTGGCTCTGACACCCAGG - Intronic
1075915943 10:126167266-126167288 CAGTGCCAGCTGTGTGACCCCGG - Intronic
1075944361 10:126419461-126419483 GAGTCTCAGCTCTGTGTCCAGGG - Intergenic
1076024648 10:127101392-127101414 CTGTCTTTGTTCTGTCACCCAGG + Intronic
1076260503 10:129061151-129061173 GAGTCTCCCCTCTGTCGCCCAGG + Intergenic
1076400740 10:130183282-130183304 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1076414751 10:130277709-130277731 CAGCCAGAGCTCTGTCACACAGG - Intergenic
1076912474 10:133398372-133398394 GAGTCTTGGCTCTGTCACCCAGG - Intronic
1077041394 11:525511-525533 CTCTGTCACCTCTGTCACCCAGG - Intergenic
1078075148 11:8151888-8151910 GAGTCTCACTTCTGTCCCCCAGG - Intronic
1078165999 11:8885964-8885986 GAGTTTCAGCTCTGTCACCCAGG + Intronic
1078270771 11:9792776-9792798 GGGTCTCAACCCTGTCACCCAGG + Intronic
1078792699 11:14560414-14560436 CACCCTCAGCTCTGCCATCCAGG + Intronic
1078913437 11:15755340-15755362 TGATCTCAGCTCTGTCTCCCTGG + Intergenic
1079053752 11:17187022-17187044 CAGGATCTGCTCTATCACCCAGG - Intronic
1079112386 11:17612225-17612247 CAGTCCCAGCACTGTCCCCAGGG + Exonic
1079646443 11:22869246-22869268 CAGAGTCCACTCTGTCACCCAGG - Intergenic
1079856645 11:25612814-25612836 CTGTCTCGGCTGTGTCACACAGG + Intergenic
1080448750 11:32361250-32361272 GAGTCTCCGCTCTGTAGCCCAGG - Intergenic
1080511883 11:32982928-32982950 GGATCTCAGCTCTGTCACCCAGG + Intronic
1080847494 11:36038993-36039015 GAGTCTTGCCTCTGTCACCCAGG + Intronic
1080886769 11:36375208-36375230 CAGTTTCCCCTCTGTCATCCAGG - Intronic
1081193753 11:40136290-40136312 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1081795503 11:45816507-45816529 CAGGGTCTGTTCTGTCACCCAGG - Intergenic
1081949931 11:47036701-47036723 CAGTCTCTTCTCTGTCACCCAGG + Intronic
1082091672 11:48095603-48095625 GAGTTTTTGCTCTGTCACCCAGG + Intronic
1082626914 11:55497253-55497275 CTCTTTCAGCTCTGCCACCCAGG - Intergenic
1082856531 11:57812492-57812514 GAGTCTCAACTCTGTCGCCCTGG - Intronic
1083036446 11:59641725-59641747 CAGGGTCTTCTCTGTCACCCAGG - Intronic
1083039390 11:59670812-59670834 TAGTCTTTGCTCTGTCACCCAGG - Intergenic
1083230186 11:61312533-61312555 GAGTCTCAGCTCTGTTATTCAGG + Intronic
1083344220 11:61978334-61978356 GGGTCTCAACTCTGTCACCGAGG + Intergenic
1083366453 11:62144304-62144326 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1083401205 11:62424703-62424725 GGGTCTCACCTTTGTCACCCAGG - Intergenic
1083411704 11:62497936-62497958 AAGTCTCCCCTCTGTCACCCAGG - Intronic
1083542478 11:63522866-63522888 GAGTCTCAACTCTGTCACCCAGG + Intergenic
1083660201 11:64248535-64248557 CAGCCCCAGCTGTGTGACCCCGG - Intergenic
1083807010 11:65080437-65080459 CGGTCTCAACTCTGTTGCCCAGG + Intronic
1083841342 11:65306236-65306258 AAGTCTCATCCCTGTCCCCCAGG - Intergenic
1083913542 11:65725323-65725345 CAGAGTCCGCTCTGTCAGCCAGG + Intergenic
1084082635 11:66838755-66838777 GAGTCTCACCTCTGTCGCCCAGG + Intronic
1084131320 11:67137821-67137843 GGGTCTCAGCTCTGTCGCCCAGG + Intronic
1084136623 11:67188156-67188178 GGGTCTTGGCTCTGTCACCCAGG - Intronic
1084144990 11:67260486-67260508 GAGTCTCAACTGTGTCGCCCAGG - Intergenic
1084301182 11:68253717-68253739 CAGGGTCTTCTCTGTCACCCAGG + Intergenic
1084325799 11:68399343-68399365 GGGTCTGGGCTCTGTCACCCAGG - Intronic
1084477067 11:69395086-69395108 GAGGCTTTGCTCTGTCACCCAGG + Intergenic
1084544688 11:69809036-69809058 GAGTCTCAGCTCTCTGACTCTGG + Intergenic
1084707515 11:70823851-70823873 CAGTGCCACCTCTGTCCCCCAGG - Intronic
1084740373 11:71135510-71135532 GAGTCTCACTTTTGTCACCCAGG + Intronic
1084925746 11:72510203-72510225 CAGTCTCAGCTCAGTAGTCCTGG + Intergenic
1084951929 11:72671247-72671269 CAGTGTCTGCTCTGTGTCCCCGG + Intronic
1084969917 11:72765527-72765549 CAATCCCAGCTCTGTCTCCTGGG + Intronic
1085002642 11:73054699-73054721 GAGTCTTGGCTTTGTCACCCAGG + Intronic
1085044451 11:73344984-73345006 CACACTCAGCTCTGTGACACAGG - Intronic
1085307377 11:75495240-75495262 GAGTGACAGCTCTGTCACTCAGG - Intronic
1085417035 11:76326038-76326060 AAGTCACAGCTCTGAGACCCAGG - Intergenic
1085469952 11:76751354-76751376 CAGGGTCTCCTCTGTCACCCAGG - Intergenic
1085899775 11:80684831-80684853 GAGTCTCACCTCTGTCACCCAGG - Intergenic
1086131522 11:83406996-83407018 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
1086225345 11:84501538-84501560 GAGTCTCGGCTCTGTCACCCAGG - Intronic
1086344971 11:85886884-85886906 CAAGGTCTGCTCTGTCACCCAGG - Intronic
1086361167 11:86061253-86061275 CACTGTAAGCTCTGTCTCCCAGG - Intronic
1086376972 11:86210814-86210836 GAGTCTCACTTTTGTCACCCAGG - Intergenic
1086609668 11:88740603-88740625 TAATCTCAACTCTGTCACTCTGG - Intronic
1086652258 11:89307060-89307082 CAGTGTGAGCTCTGTTACCTTGG - Intergenic
1086752748 11:90518577-90518599 CAGAGTCTGCTCTGTCGCCCAGG + Intergenic
1086774064 11:90807332-90807354 CAGTCTCCCCTCTATCACACAGG - Intergenic
1087431877 11:98065703-98065725 CAGTCTCCGCTCTGTCACCCAGG - Intergenic
1087481417 11:98705760-98705782 CACTCCCTGTTCTGTCACCCTGG - Intergenic
1087836721 11:102882280-102882302 GGGTTCCAGCTCTGTCACCCAGG - Intergenic
1087986349 11:104686087-104686109 CAGTGTTCACTCTGTCACCCAGG + Intergenic
1088232508 11:107687455-107687477 GAGTTTCAACTCTGTCACCCAGG + Intergenic
1088327673 11:108617369-108617391 GGGTCTCAACTCTGTCGCCCAGG - Intergenic
1088471488 11:110191828-110191850 CAGAGTCTCCTCTGTCACCCAGG - Intronic
1089037955 11:115415758-115415780 CAATCTCAGCTCTGCCTCCCAGG - Intronic
1089247169 11:117130354-117130376 GAGTTTCAGCTTTGTCACCCAGG - Intergenic
1089269533 11:117292214-117292236 GAGTATTAGCTCTGTCACCCAGG + Intronic
1089315161 11:117586501-117586523 AGGTCTCAGCTCTGTGACCTTGG - Intronic
1089407386 11:118209544-118209566 GGGTCTCAGCTCTGTCACCCAGG + Intronic
1089481670 11:118810583-118810605 GGGTCTCAGCTCTGTTGCCCAGG - Intergenic
1089487949 11:118861706-118861728 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1089504015 11:118951444-118951466 TATTTCCAGCTCTGTCACCCAGG + Intronic
1089961821 11:122623489-122623511 TGCTCTGAGCTCTGTCACCCAGG + Intergenic
1090356629 11:126145005-126145027 CAGACATTGCTCTGTCACCCAGG + Intergenic
1090704550 11:129324653-129324675 CAGTCCCAGCCCTGTCCCCAGGG - Intergenic
1091432962 12:452402-452424 CAGGTCCTGCTCTGTCACCCAGG - Intergenic
1091699064 12:2648110-2648132 GGGTCTCAGCTCTGTTGCCCAGG - Intronic
1091742309 12:2968421-2968443 GGGTCTTAACTCTGTCACCCAGG + Intronic
1091749894 12:3015679-3015701 GAGACTCCACTCTGTCACCCAGG + Intronic
1091919263 12:4291122-4291144 CAGGCTTACCTCTGGCACCCCGG + Intronic
1092163805 12:6330334-6330356 CTCTCTCAGCCCTGGCACCCTGG + Intronic
1092384865 12:8028318-8028340 GAGTCTCCGATCTGTCGCCCAGG + Intergenic
1092467178 12:8743326-8743348 GACTCTTGGCTCTGTCACCCAGG - Intronic
1092467533 12:8746570-8746592 GAGTCTCAACTCTGTCGCCCAGG - Intronic
1092785698 12:12024598-12024620 GAGTCTCACTTCTTTCACCCAGG - Intergenic
1092821161 12:12354971-12354993 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
1093366391 12:18304280-18304302 GAGTCTTCACTCTGTCACCCAGG + Intronic
1093454640 12:19353177-19353199 CAGAGTCTTCTCTGTCACCCAGG + Intronic
1093479243 12:19587804-19587826 CAGAGTCTGCTCTGTCACCCAGG + Intronic
1093681858 12:22011529-22011551 GGGTCTCACTTCTGTCACCCAGG - Intergenic
1093740022 12:22675091-22675113 CAGTCTTTGCTTTGTCATCCAGG + Intronic
1093777758 12:23097457-23097479 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1093865391 12:24221048-24221070 AAATCTCAGCTCTGTCACATGGG - Intergenic
1094122097 12:26985597-26985619 CAGTCTCACTCTTGTCACCCAGG - Intronic
1094335097 12:29341390-29341412 CAGGGTCTGCTCTGTCACCCAGG + Intronic
1094360759 12:29628686-29628708 CAGACTTCGCTCTGTCACCCAGG + Intronic
1094373087 12:29759468-29759490 CAGGGTCCACTCTGTCACCCAGG - Intronic
1094562226 12:31566117-31566139 GAGTTTCACTTCTGTCACCCAGG - Intronic
1094566166 12:31600121-31600143 CAGAGTCCACTCTGTCACCCAGG - Intergenic
1094566559 12:31603675-31603697 AAGTCTCTGTTCTGTCACTCAGG - Intergenic
1094574137 12:31668515-31668537 GAGTCTCAGCTCTGTCGTCCAGG + Exonic
1094613163 12:32012935-32012957 GAGTCTCCACTCTGTCACCCAGG - Intergenic
1094672638 12:32585806-32585828 AGGTCTCAGCTCTGTGGCCCAGG - Intronic
1095221831 12:39625469-39625491 CAGAGTCTGCTCTGTCGCCCAGG + Intergenic
1095277069 12:40298744-40298766 GAGTCTCGCCTCTGTCACCCAGG - Intronic
1095408980 12:41901490-41901512 CAGTGTTTGCTCTGTCATCCAGG - Intergenic
1095411674 12:41932118-41932140 CTACCTCAGCTCTGTCGCCCAGG + Intergenic
1095466275 12:42490894-42490916 TAGTCTTAACTCTGTCACTCAGG + Intronic
1095496447 12:42789552-42789574 GAGTCTCGTTTCTGTCACCCAGG + Intergenic
1095787033 12:46120946-46120968 CAGTTTCACCTTTGTAACCCAGG - Intergenic
1095896609 12:47286171-47286193 CAGAATCCACTCTGTCACCCAGG - Intergenic
1095926812 12:47586689-47586711 GAGTCTCATCTCTGTCACCCAGG - Intergenic
1096057223 12:48664301-48664323 GAGTCTCACATCTGTCGCCCAGG + Intronic
1096144906 12:49271991-49272013 CAGGGTCTGCTCTGTCATCCAGG + Intronic
1096222967 12:49843605-49843627 CCGACTCAGCCCTGTCCCCCAGG + Intergenic
1096329024 12:50692809-50692831 GAGTCTCACCTCTGTCACCCAGG - Intronic
1096473533 12:51894511-51894533 GAGTCTCATCTCTGTCACCCAGG + Intergenic
1096474244 12:51898243-51898265 CACTCTGTACTCTGTCACCCAGG - Intergenic
1096625578 12:52893663-52893685 GAGTCTTCGCTCTGTCACCCAGG - Intergenic
1096646227 12:53038093-53038115 GAGTCTTAACTCTGTCGCCCAGG - Intronic
1096992496 12:55816637-55816659 CAGTTTCAGCTATATCAGCCTGG + Intronic
1097709222 12:62900145-62900167 TAGTCTCAGTTCTGCCACTCAGG + Intronic
1097801737 12:63922002-63922024 GAGTCTCACCTCTGTCGCTCAGG + Intronic
1097852763 12:64429467-64429489 GAGTCTTGGCTCTGTCACCCAGG + Intronic
1097858343 12:64491596-64491618 CAGTCTCGGCTCTGTCACCCAGG - Intronic
1097968655 12:65608946-65608968 GAGTCTGAGCCCTGTCACCCAGG + Intergenic
1098112635 12:67139424-67139446 GAGTCTCCACTCTGTCACCCAGG - Intergenic
1098255758 12:68613363-68613385 CAGGTCTAGCTCTGTCACCCAGG - Intronic
1098263709 12:68697396-68697418 CAGGGTCTACTCTGTCACCCTGG - Intronic
1098282113 12:68872276-68872298 CAGTCTCAACTCCGTCACCCAGG + Intronic
1098298905 12:69033723-69033745 GAGTCTCAGTCTTGTCACCCAGG + Intergenic
1099106438 12:78502351-78502373 GAGTCTCTGCTCTGTCGCCTAGG - Intergenic
1099195363 12:79609041-79609063 GAGTCTCACTCCTGTCACCCAGG - Intronic
1099220918 12:79912666-79912688 CAGGCTTTCCTCTGTCACCCAGG - Intronic
1099460318 12:82912911-82912933 AGGTCTCAACTCTGTCACCCAGG - Intronic
1099999905 12:89820605-89820627 GAGTCTCACTTTTGTCACCCAGG - Intergenic
1100228773 12:92586291-92586313 CAGTGTCACCTCTGTAATCCTGG + Intergenic
1100484180 12:95008840-95008862 GAGTTTCCCCTCTGTCACCCAGG - Intergenic
1100585050 12:95971722-95971744 GAGTCTCGGCTCTGTCACCCAGG - Intergenic
1100633770 12:96414423-96414445 GAGTCTCACTTTTGTCACCCAGG - Intergenic
1100973681 12:100099016-100099038 GAGTCTCAACTCTGTCGCCCAGG + Intronic
1101426265 12:104591083-104591105 CACTCACTGCTCTGTCAGCCTGG - Intronic
1101629553 12:106479837-106479859 CTTGCTCTGCTCTGTCACCCAGG + Intronic
1101706074 12:107222598-107222620 GAGTCTCTGCTCTGTCATCCGGG + Intergenic
1101733908 12:107448664-107448686 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1101758314 12:107638837-107638859 AAATCTCAGCTCTGTAACCTTGG - Intronic
1101938384 12:109079387-109079409 GGGTCTTAGCTCTGTCACCGAGG + Intronic
1102074273 12:110047656-110047678 TAGTGTCTCCTCTGTCACCCAGG - Intronic
1102104987 12:110313734-110313756 AAGTCTCGGCTCTGTCACCCAGG + Intronic
1102119940 12:110432387-110432409 GGGTCTCAACTCTGTCGCCCAGG + Intergenic
1102159885 12:110760005-110760027 GTGTCTTCGCTCTGTCACCCAGG - Intergenic
1102293262 12:111718503-111718525 GAGTTTTTGCTCTGTCACCCAGG + Intronic
1102377066 12:112431116-112431138 CAGTTTCACATCTGTGACCCGGG - Intronic
1102506635 12:113388314-113388336 GAGTCTCTGCTCTGTCACCCAGG - Intronic
1102609167 12:114096084-114096106 CAGTCTCACCTCTGTTGCCCAGG + Intergenic
1102890521 12:116555128-116555150 GAGTCTCAACTCTGCCACCCAGG - Intergenic
1102988136 12:117295001-117295023 CATTCTCAGCTCTGGAGCCCAGG - Intronic
1103026039 12:117574831-117574853 CAGTCCAATCCCTGTCACCCAGG + Intronic
1103102822 12:118194770-118194792 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1103122192 12:118389535-118389557 CAGGTTTCGCTCTGTCACCCAGG + Intronic
1103144591 12:118583575-118583597 AAGTCTCACTTTTGTCACCCAGG - Intergenic
1103367482 12:120393867-120393889 AAGTTTTTGCTCTGTCACCCAGG + Intergenic
1103516919 12:121514138-121514160 TTGTCCCACCTCTGTCACCCAGG + Intronic
1103530043 12:121594848-121594870 GAGTCTTGCCTCTGTCACCCAGG - Intergenic
1103542313 12:121674544-121674566 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
1103647802 12:122408845-122408867 GAGTCTCCACTCTGTCACCCAGG + Intronic
1103770790 12:123322318-123322340 CAGTGTCTACTCTGTCTCCCAGG + Intronic
1103777459 12:123377000-123377022 GAGTCTTCACTCTGTCACCCAGG + Intergenic
1103794810 12:123496036-123496058 GAGTCTCACCCCTGTCGCCCAGG + Intronic
1103811646 12:123618737-123618759 CAAACACAGCTCTGTCAGCCAGG - Exonic
1103823321 12:123716090-123716112 GAGTCTCAATTCTGTCGCCCAGG + Intronic
1103985735 12:124766301-124766323 CAAGCTCAGCTCTGGCATCCTGG - Intergenic
1104055544 12:125227411-125227433 GAATCCCAGCTCTGCCACCCTGG - Intronic
1104143089 12:126006964-126006986 CCCTTTCAGCTCTGTCACCCAGG + Intergenic
1104461593 12:128960740-128960762 GATACCCAGCTCTGTCACCCAGG - Intronic
1104714718 12:131008759-131008781 CAGTCTCAGCCCCGTCCACCTGG - Intronic
1104733706 12:131123080-131123102 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1104970757 12:132529629-132529651 CACCCTAAGCTCTGCCACCCTGG + Intronic
1104970798 12:132529759-132529781 TGGGCTCAGCTCTGCCACCCTGG + Intronic
1105300212 13:19127094-19127116 GGGTCTTAACTCTGTCACCCAGG + Intergenic
1105354144 13:19643267-19643289 CAGTCTTGCTTCTGTCACCCAGG + Intronic
1105448986 13:20481883-20481905 GAGTCGCACCTTTGTCACCCAGG - Intronic
1105457949 13:20558653-20558675 CAGTCTCATTCTTGTCACCCAGG + Intergenic
1105814270 13:24019896-24019918 GAGTCTCATCTCTCTCGCCCTGG + Intronic
1105887685 13:24655980-24656002 CAGTCTCGGCTCTGCCTCCCGGG - Intergenic
1106173885 13:27311765-27311787 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1106441526 13:29777790-29777812 GAGTCTCTGCTCTGTCACCCAGG + Intronic
1106527527 13:30555065-30555087 GAGTCTCTGCTCTGTTGCCCAGG + Intronic
1106723316 13:32458138-32458160 CACTGTCAGCTCCGTCTCCCAGG + Intronic
1106874645 13:34058613-34058635 CAGAGTCTTCTCTGTCACCCAGG + Intergenic
1107436377 13:40383805-40383827 CAATGTCATCCCTGTCACCCAGG + Intergenic
1107462548 13:40618102-40618124 CGGTCCCAGCTCTGTCACCCAGG + Intronic
1107496635 13:40931743-40931765 GAGTCTTAGCTCTGTCACCCAGG - Intergenic
1107717182 13:43212052-43212074 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
1107878266 13:44809667-44809689 AAGTTCTAGCTCTGTCACCCAGG + Intergenic
1108025230 13:46170528-46170550 CAGTCACTGCTCTGTCTCCAAGG - Intronic
1108344804 13:49535006-49535028 GAGCCTCTGCTCTGTCACCCAGG - Intronic
1108922058 13:55687980-55688002 GAGTCTCACCTCTGTTGCCCAGG - Intergenic
1109072792 13:57789649-57789671 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1109317392 13:60766351-60766373 CTATCTCAACACTGTCACCCTGG - Intergenic
1109377188 13:61511323-61511345 CAGAGTCTGCTCTGTCACCCAGG - Intergenic
1109512058 13:63390054-63390076 CAGTGTCTCCTCTGTCGCCCAGG + Intergenic
1110469855 13:75847003-75847025 CAGAGTCTGCTCCGTCACCCAGG - Intronic
1110959599 13:81604815-81604837 CAGTCTCGCCTCTGTCACCCAGG - Intergenic
1110996513 13:82116680-82116702 CACTCTCAGAGCTTTCACCCAGG - Intergenic
1111240606 13:85468603-85468625 GGGTCTTTGCTCTGTCACCCAGG - Intergenic
1111339583 13:86865606-86865628 CAGAGTCTGCTCTGTCGCCCAGG - Intergenic
1111585172 13:90274048-90274070 CAGTCTCAACTCCATCTCCCTGG + Intergenic
1111585926 13:90284690-90284712 GAGTCTTCTCTCTGTCACCCAGG + Intergenic
1111633179 13:90869680-90869702 CAGGGTTTGCTCTGTCACCCAGG + Intergenic
1111722836 13:91968992-91969014 GAGTCTCCACTCTGTCAACCAGG + Intronic
1111799554 13:92965008-92965030 CACTGTGAGCTCTGTCTCCCGGG - Intergenic
1111939221 13:94591565-94591587 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1112011612 13:95298261-95298283 GTTGCTCAGCTCTGTCACCCAGG - Intronic
1112025054 13:95404087-95404109 CAATCCCAGCTCTGCCACTCAGG - Intergenic
1112028217 13:95432288-95432310 AGATCTCAGCTCTGTCACCTGGG + Intergenic
1112182266 13:97095237-97095259 GAGTCTTTGGTCTGTCACCCAGG - Intergenic
1112266210 13:97926128-97926150 CAGGGTCTGCTCTGTTACCCAGG + Intergenic
1112299807 13:98219689-98219711 CAGAGTCTTCTCTGTCACCCAGG + Intronic
1112348852 13:98615821-98615843 CAGTGTTTGCTCTGTTACCCAGG - Intergenic
1112511758 13:100016066-100016088 CAGAGTCTGCTCTGTCACCCAGG + Intergenic
1112694512 13:101932505-101932527 GAGTCTCACTTATGTCACCCAGG - Intronic
1113112027 13:106833726-106833748 CTTTCTCAGCTCAGTCACCCTGG + Intergenic
1113491199 13:110693433-110693455 CACTGTAAGCTCTGCCACCCAGG + Intronic
1114007418 14:18330364-18330386 CGGAGTCTGCTCTGTCACCCAGG + Intergenic
1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1114297906 14:21346524-21346546 CAGAGTCTGCTTTGTCACCCAGG - Intronic
1114317086 14:21519446-21519468 GAGTCTTAACTCTGTCACCAAGG - Intergenic
1114740146 14:25088464-25088486 GGGTCTCTACTCTGTCACCCAGG - Intergenic
1114770868 14:25428079-25428101 CAGTCTCAGCAATTTAACCCGGG - Intergenic
1115196664 14:30808082-30808104 GAGTCTCTGCTCTGTCACCCAGG + Intergenic
1115216686 14:31020471-31020493 CAGTTTTCGCTCTGTCACTCAGG - Intronic
1115230009 14:31150384-31150406 TGGTCTCAACTCTGTCATCCAGG + Intronic
1115580352 14:34751672-34751694 TGGTCTTGGCTCTGTCACCCAGG - Intergenic
1115609382 14:35036911-35036933 GGGTCTTTGCTCTGTCACCCAGG + Intergenic
1115644346 14:35357506-35357528 AGATCTGAGCTCTGTCACCCAGG + Intergenic
1115657187 14:35455081-35455103 GAGTCTCACCTCAGCCACCCAGG + Intergenic
1115667616 14:35570242-35570264 GAGTCTCACTTTTGTCACCCAGG - Intronic
1115670000 14:35600254-35600276 CAGGGTCTGCTCTATCACCCAGG + Intronic
1115814441 14:37147865-37147887 GAGTCTCAACTCTGTAGCCCAGG + Intronic
1115996584 14:39201611-39201633 GAGTCTTTGCTCTGTCGCCCAGG - Intergenic
1116003602 14:39269543-39269565 GGGTCTCATCCCTGTCACCCAGG + Intronic
1116716776 14:48437631-48437653 GAGTCTCTGCTCTGTCACCCAGG + Intergenic
1116914179 14:50506382-50506404 GGGTCTCACTTCTGTCACCCAGG + Intronic
1117269768 14:54131312-54131334 GGGTCTCGGCTCTGTTACCCAGG + Intergenic
1117299897 14:54414569-54414591 TTGTCTCTTCTCTGTCACCCAGG + Intronic
1117389862 14:55252329-55252351 GAGTCTCACTCCTGTCACCCAGG - Intergenic
1117410010 14:55441793-55441815 CAGAGTCTGCTCTGTCACCCAGG + Intronic
1117949074 14:61062704-61062726 GAGTCTCACTTCCGTCACCCAGG + Intronic
1118105428 14:62654013-62654035 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1118229317 14:63932678-63932700 GGGTCTCAACTCTGTCACCAAGG - Intronic
1118320672 14:64750748-64750770 AAGTCTCGTCTCTGTCACCCAGG - Intronic
1118447851 14:65867981-65868003 CAGTCTCATCTCTACCACTCTGG - Intergenic
1118557737 14:67044309-67044331 GAGTCTTGTCTCTGTCACCCAGG - Intronic
1118809249 14:69261325-69261347 CACGCACAGCTCTGTCACCTGGG - Intronic
1118844155 14:69533946-69533968 CAGGGTTTGCTCTGTCACCCAGG + Intergenic
1118855619 14:69619743-69619765 GGGTCTCAACTGTGTCACCCAGG - Intronic
1118871380 14:69745762-69745784 CAGCCACTGCTCTGTCGCCCAGG - Intronic
1119068732 14:71558707-71558729 CAGGATTTGCTCTGTCACCCAGG + Intronic
1119214510 14:72858280-72858302 GAGTCTTAACTCTGTCACCCAGG - Intronic
1119289481 14:73483877-73483899 GAGTCTCATCTCTGTCACCCAGG + Intronic
1119349476 14:73952146-73952168 GAGTCTCTGCTCTGTCACCCAGG + Intronic
1119361486 14:74053898-74053920 GAGTCTTCGCTCTGTCACCCAGG + Intronic
1119393205 14:74305304-74305326 CAGTCTCACTCTTGTCACCCAGG - Intronic
1119399842 14:74355855-74355877 GAGTCTCATTCCTGTCACCCTGG + Intronic
1119728114 14:76934394-76934416 TAGTCTCGGCTCTGTTGCCCAGG - Intergenic
1119730693 14:76949223-76949245 CAGTCTTCCCTCTGTCCCCCAGG + Intergenic
1119743884 14:77030753-77030775 CAGAGTCCACTCTGTCACCCAGG + Intergenic
1119795976 14:77397853-77397875 GAGTTTTAGCTCTGTCACCCAGG - Intronic
1119885101 14:78133850-78133872 GAGTTTTTGCTCTGTCACCCAGG + Intergenic
1120766393 14:88330929-88330951 GAGTCTTGCCTCTGTCACCCAGG + Intergenic
1120791408 14:88587186-88587208 GAGTCTCACTTTTGTCACCCAGG + Intronic
1120928017 14:89817493-89817515 GAGTCTCAGCTCTATCACCCAGG - Intronic
1120951981 14:90050026-90050048 CAGGGTCAGCACTGTCCCCCAGG + Intergenic
1121160410 14:91734154-91734176 GAGTCTCATCTCTGTCATCCAGG + Intronic
1121191715 14:92036758-92036780 CAGGGTCGTCTCTGTCACCCAGG + Intronic
1121236171 14:92392693-92392715 CACTCTCAACACTGTCACACTGG - Intronic
1121495832 14:94390837-94390859 CCCTTTCAGCTCTGTGACCCGGG + Intergenic
1121659208 14:95622247-95622269 CAGTTTCATTCCTGTCACCCAGG - Intergenic
1121763495 14:96465435-96465457 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
1121763592 14:96466260-96466282 GAGTCCTCGCTCTGTCACCCAGG + Intronic
1122185114 14:99986264-99986286 CAGAGTCCACTCTGTCACCCAGG - Intronic
1122471263 14:101968315-101968337 GGGTCTCAACTGTGTCACCCAGG + Intronic
1122495178 14:102148512-102148534 GAGTCTCAGCTCTGTCACCCAGG - Intronic
1122525026 14:102375745-102375767 CAGTCACAGCTCTGACAGGCAGG - Intronic
1122610889 14:102982693-102982715 CAATCTCAGCTATGCCTCCCAGG - Intronic
1122629478 14:103100759-103100781 GGGTCTCCACTCTGTCACCCAGG + Intronic
1122704533 14:103611960-103611982 AAGTCCTTGCTCTGTCACCCAGG + Intronic
1122708748 14:103639782-103639804 GGGTCTCAACTCTGTCACCCAGG + Intronic
1122730301 14:103792225-103792247 CACTCTGTCCTCTGTCACCCAGG + Intronic
1122927788 14:104916074-104916096 TGGTCTCTGCTCTGTCACCAAGG + Intergenic
1123002354 14:105302227-105302249 GAGTCTCTGCTCTGTTGCCCAGG + Exonic
1202901067 14_GL000194v1_random:39536-39558 GAGTCTCAACTTTGTCACCCAGG + Intergenic
1123706385 15:22954028-22954050 CAGTCTTCGCTCTGTCACCCAGG - Intronic
1123715637 15:23028352-23028374 CGGGCCCTGCTCTGTCACCCAGG - Intronic
1123776039 15:23581054-23581076 GGGTCTTGGCTCTGTCACCCAGG - Intronic
1123785372 15:23666319-23666341 GAGTCTCGCTTCTGTCACCCAGG + Intergenic
1123897620 15:24843945-24843967 CAGAGTCAGCTCTATCGCCCAGG - Intronic
1123958272 15:25364180-25364202 GGGTCTTAACTCTGTCACCCAGG - Intronic
1124080519 15:26490505-26490527 CAGTCTTTGCTCTGTCGCCCAGG + Intergenic
1124451739 15:29799438-29799460 GAGTCTCGCCTCTGTCACCCAGG + Intronic
1124525255 15:30444916-30444938 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
1124599814 15:31124626-31124648 GAGTCTTAACTCTGTCATCCAGG - Intronic
1124609124 15:31195534-31195556 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
1124773400 15:32562794-32562816 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
1124811062 15:32938501-32938523 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1124991985 15:34684242-34684264 GGGTCTCAGCTCTGTCACCCTGG + Intergenic
1125335246 15:38620218-38620240 CAGTCTCAGTTCTTTCTCCATGG - Intergenic
1125365725 15:38913686-38913708 CTCTCTCTGCTCGGTCACCCAGG + Intergenic
1125385503 15:39132302-39132324 CAGTCTCAGCCCTGTAACTATGG - Intergenic
1125388054 15:39159172-39159194 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
1125522104 15:40354040-40354062 TTGTCTCAACTCTGTCAGCCTGG - Intronic
1125531042 15:40413714-40413736 GAGTCTTGGCTCTGTCACCCAGG + Intronic
1125642104 15:41239800-41239822 GAGTCTCCTCTCTGTCACCCAGG + Intronic
1125729305 15:41883814-41883836 CAGAATCTGCTCTGTCACCCAGG + Intronic
1125840249 15:42793770-42793792 CAATCTCAGCTCTGCCTCCTGGG - Intronic
1125963099 15:43848910-43848932 AAGTCTCAACTCTGTCGCCCAGG - Intronic
1126028827 15:44476092-44476114 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1126776355 15:52103988-52104010 CAGGATCTCCTCTGTCACCCAGG + Intergenic
1126828008 15:52570615-52570637 GAGTCTCAACTCTGTCACCCAGG + Intergenic
1127141358 15:55981062-55981084 GAGTCTCACCTCTGTCGCCCAGG + Intronic
1127248456 15:57204428-57204450 GAGTCTTGGCTCTGTCACCCAGG - Intronic
1127268486 15:57380056-57380078 GAGACTCTGCTCTGTCACCCAGG + Intronic
1127347445 15:58114617-58114639 GAGTTCCTGCTCTGTCACCCAGG - Intronic
1127442284 15:59021884-59021906 CAGAGTTTGCTCTGTCACCCAGG + Intronic
1128036674 15:64533074-64533096 CAGAGTCTGCTCTGTCACCAAGG + Intronic
1128164328 15:65449433-65449455 CAGAGTCCACTCTGTCACCCAGG + Intronic
1128167755 15:65482305-65482327 GAGTCTTCACTCTGTCACCCAGG + Intronic
1128199033 15:65788827-65788849 AAGTCCTGGCTCTGTCACCCAGG - Intronic
1128273175 15:66329884-66329906 CAGTCTCAATTTTGTCACCCAGG - Intronic
1128318349 15:66675411-66675433 CAGAGTCTGCTCTGTCGCCCAGG - Intronic
1129315006 15:74736865-74736887 CAGTCTCAACTATGCTACCCAGG + Intergenic
1129364533 15:75046187-75046209 GAGTCTCACCTCTGTAGCCCAGG - Intronic
1129396191 15:75248623-75248645 TAGGGTCACCTCTGTCACCCAGG + Intergenic
1129409597 15:75342040-75342062 GGGTCTCAGCTCTGTTATCCAGG - Intronic
1129422585 15:75440954-75440976 GAGTCTTCGCTCTGTCACCCAGG - Intronic
1129436398 15:75544502-75544524 CAGGTTCTGCTCTGTCACCCAGG - Intronic
1129437689 15:75555528-75555550 CAGTCCTCGCTCTGTCACCCAGG + Intronic
1129601017 15:76998210-76998232 CTCTGTCAGCTCTGTCACCCAGG - Intronic
1129638782 15:77352183-77352205 CAGGGTTTGCTCTGTCACCCAGG - Intronic
1129692738 15:77723034-77723056 CCGTCCCAGCTGTGTGACCCAGG + Intronic
1129791680 15:78344888-78344910 GGGTCTCAGCTCTGTTGCCCAGG - Intronic
1129853440 15:78808906-78808928 AAGTGACAGTTCTGTCACCCAGG - Intronic
1130087021 15:80786260-80786282 AAGTCTCACTTTTGTCACCCGGG + Intronic
1130306819 15:82717637-82717659 GAGTCTTCGCTCTGTCACCCAGG + Intergenic
1130344916 15:83034060-83034082 CAGTGTCTCCTCTGTCACCCAGG - Intronic
1130402846 15:83573618-83573640 CAGCCTCATCTCTGTCACATAGG - Intronic
1130541055 15:84821138-84821160 TAGGCTCAGGGCTGTCACCCAGG - Intronic
1130743084 15:86622302-86622324 GAGTCTCAGTCTTGTCACCCAGG - Intronic
1130900788 15:88205666-88205688 CAGGGTCAGCCCTCTCACCCCGG + Intronic
1130935494 15:88467281-88467303 CAGTCTAAGCTCTCGCAGCCTGG - Exonic
1131159218 15:90093643-90093665 GAGTCTTTGGTCTGTCACCCAGG + Intronic
1131254566 15:90853510-90853532 CAGCCTCAAGCCTGTCACCCAGG + Intergenic
1131286757 15:91065812-91065834 CAGTAACTGCCCTGTCACCCTGG + Intergenic
1131322246 15:91405763-91405785 CTGTCTTTGCACTGTCACCCGGG + Intergenic
1131475843 15:92738626-92738648 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1131500937 15:92965536-92965558 GAGTCTCGGCTCTGTCGCCCAGG - Intronic
1131809139 15:96154072-96154094 GAGTCCCAGCTCGGTCACCCAGG - Intergenic
1132037753 15:98501021-98501043 CAGTCACTGCTCTGTTTCCCTGG + Intronic
1132142900 15:99409611-99409633 CAGTCTCACTCGTGTCACCCAGG - Intergenic
1132275804 15:100562981-100563003 CTTGCTCTGCTCTGTCACCCAGG + Intronic
1132547198 16:538781-538803 CAGTCAGTGCTCTGACACCCGGG - Intronic
1132682935 16:1151151-1151173 CAGAGTCCACTCTGTCACCCAGG + Intergenic
1132700368 16:1219712-1219734 CAGCCTCAGCTCTGTGCCCCTGG + Intronic
1132737908 16:1396328-1396350 CACTCTAAGCTCTGCCTCCCGGG + Intronic
1132757140 16:1491161-1491183 TATTCTTTGCTCTGTCACCCAGG - Intergenic
1132987558 16:2775844-2775866 CAATCCCAGCTCTGTCACCCTGG + Intronic
1133136944 16:3718641-3718663 GAGTCACAGCTCTGTCGCCCAGG - Intergenic
1133149354 16:3815502-3815524 GAGTCTCCCCTCTGTCATCCAGG - Intronic
1133250231 16:4476024-4476046 GAGTCTCAACTCTGACACCTCGG - Exonic
1133260321 16:4545230-4545252 CAGGGTCTGTTCTGTCACCCAGG + Intergenic
1133266286 16:4586232-4586254 CAGAATCTGCTCTGTCGCCCAGG - Intronic
1133268466 16:4599071-4599093 GGGTCTCCGCTCTGTCACCTAGG - Intronic
1133497189 16:6329910-6329932 GAGTCTCACTTCTGTCACCCAGG - Intronic
1133823266 16:9255848-9255870 CAGTTTCAGCTCTGCCACCTTGG + Intergenic
1133927162 16:10202538-10202560 GAGTCTCACTTTTGTCACCCAGG - Intergenic
1134090835 16:11390914-11390936 CAGTCCCAGCGCTTTCACACAGG - Intronic
1134132431 16:11658886-11658908 CTGTGCCAGCTCTGTAACCCAGG - Intergenic
1134235750 16:12464477-12464499 GGGTCTCAGCTCTGACACCCAGG + Intronic
1134390065 16:13811285-13811307 CAGTCTCGGCTCTGTCACCCAGG - Intergenic
1134626657 16:15727224-15727246 GAGTCTTAACTCTGTTACCCAGG + Intronic
1134638879 16:15813139-15813161 GAGTTTCACCCCTGTCACCCAGG - Intronic
1134789403 16:16975212-16975234 GAGTCTCAGCTCTGTTGCCCAGG - Intergenic
1134813329 16:17185969-17185991 GAGTCTTCACTCTGTCACCCAGG - Intronic
1134827162 16:17294080-17294102 CATTCTCAGCACAGTCGCCCAGG - Intronic
1135309643 16:21395527-21395549 CGGATTCTGCTCTGTCACCCAGG + Intergenic
1135432583 16:22398737-22398759 GAGTCTCAAATCTGTCATCCAGG - Intronic
1135589153 16:23692712-23692734 CAAAATCAGCTCTGCCACCCTGG - Intronic
1135795455 16:25436901-25436923 GAGTCTCAGCTCTGTTGCCCAGG - Intergenic
1135969133 16:27059508-27059530 GGGTCTCATCTCTGTCACCCAGG - Intergenic
1136079665 16:27843479-27843501 GAGTCTCTGCTCTGTCACCCAGG - Intronic
1136121200 16:28136243-28136265 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1136149219 16:28335840-28335862 CGGATTCTGCTCTGTCACCCAGG + Intergenic
1136164791 16:28446269-28446291 GGGTCTCCGCTCTGTCGCCCAGG - Intergenic
1136198175 16:28668712-28668734 GGGTCTCCGCTCTGTCGCCCAGG + Intergenic
1136214521 16:28782888-28782910 GGGTCTCCGCTCTGTCGCCCAGG + Intergenic
1136259243 16:29062732-29062754 GGGTCTCCGCTCTGTCGCCCAGG + Intergenic
1136266024 16:29119191-29119213 GAGACTCTGCTCTGCCACCCAGG + Intergenic
1136306387 16:29374651-29374673 CGGATTCTGCTCTGTCACCCAGG + Intergenic
1136511914 16:30743353-30743375 CAGTTTCACTCCTGTCACCCAGG - Intronic
1137282332 16:46988494-46988516 CAGTCTTAGCTCCATCACCCAGG + Intergenic
1137343210 16:47630454-47630476 CAGTTTCCCTTCTGTCACCCAGG - Intronic
1137645920 16:50074363-50074385 GAGTCTCAGCTCTGTCACCCAGG + Intronic
1137672406 16:50286682-50286704 CAGGCTCTGCTCTGTCCCCATGG - Intronic
1138014571 16:53416938-53416960 GAGTCTCGGCTCTATCGCCCAGG - Intergenic
1138191390 16:55016858-55016880 CAGACTCAGATCTGTGCCCCTGG + Intergenic
1138415140 16:56867279-56867301 CAGGCTCAGCTCTGACTCTCAGG + Intronic
1138518086 16:57550000-57550022 TAGTTCCAGCTCTGTCACCCAGG + Intronic
1138650784 16:58460058-58460080 CAGAGTCTGTTCTGTCACCCAGG + Intergenic
1138671688 16:58620621-58620643 GAGTCTTCGCTGTGTCACCCAGG - Intronic
1138672142 16:58623962-58623984 GAGTCTTGGCTCTGTCACCCAGG - Intronic
1138701314 16:58866480-58866502 GGATCTCAGTTCTGTCACCCAGG - Intergenic
1139275154 16:65720331-65720353 GAGTCTCGCCTCTGTCACCCAGG - Intergenic
1139279285 16:65755906-65755928 GACTCTTCGCTCTGTCACCCAGG - Intergenic
1139407883 16:66733833-66733855 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1139415751 16:66807927-66807949 CAGTCTCACCACAGTCACCCAGG + Intronic
1139533512 16:67556805-67556827 CAGAGTCTCCTCTGTCACCCAGG + Intergenic
1139554109 16:67695559-67695581 GAGTCTCATTTCTGTCACCCAGG + Intronic
1139606035 16:68019301-68019323 GAGTCTTAACTCTGTCACCCAGG - Intronic
1139606174 16:68020271-68020293 GAATATCAGCTCTGTCACCCAGG + Intronic
1139707559 16:68751975-68751997 GAGTCTCAACTCTGTCACCCAGG + Intronic
1139748658 16:69095005-69095027 CAGTGTTCGCTCTGTCACCCAGG + Intergenic
1139806688 16:69571783-69571805 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
1139935291 16:70566089-70566111 CAGTCTCACTCTTGTCACCCAGG - Intronic
1140035520 16:71368480-71368502 CAGGGTCTGCTCTGTCACTCAGG - Intronic
1140403548 16:74691742-74691764 CAGACTCATCTCTCTCATCCTGG + Intronic
1140521092 16:75582245-75582267 GAGTCTCAACTCTGTCACCCAGG - Intergenic
1140839121 16:78822466-78822488 GAGTCTCGGCTCTGTCTCTCAGG - Intronic
1141111279 16:81272914-81272936 CAGTCTTGGCTCTGCCACTCTGG - Intronic
1141146591 16:81535024-81535046 CACTCTAAGCTCTGCCTCCCGGG + Intronic
1141494111 16:84395131-84395153 CACTCCCAGCTCTGTAACCAAGG - Intronic
1141536162 16:84681724-84681746 TAGGGTCACCTCTGTCACCCAGG + Intergenic
1141601846 16:85131501-85131523 CGGAGTCTGCTCTGTCACCCAGG - Intergenic
1141809409 16:86364876-86364898 CAGTCTGGGCTCTGTCTTCCTGG + Intergenic
1141834287 16:86528492-86528514 CCGTGTCAGCCCTGTCACCTGGG + Intergenic
1142127881 16:88419254-88419276 CTGTCCGAGCTGTGTCACCCTGG - Intergenic
1142299032 16:89245714-89245736 GAGTCTTGGCTCTGTCGCCCAGG + Intergenic
1142335009 16:89482764-89482786 GAGTCTCGGCTCTGTTGCCCAGG - Intronic
1142346727 16:89558854-89558876 GAGGCTTAACTCTGTCACCCAGG + Intergenic
1203140985 16_KI270728v1_random:1765714-1765736 AGGTGACAGCTCTGTCACCCAGG + Intergenic
1142623314 17:1178536-1178558 GAGTCTCGGCTCTGTCGCCCAGG - Intronic
1142654028 17:1378021-1378043 GAGTCTCACCTCTGTTGCCCAGG - Intronic
1142697292 17:1640463-1640485 CACTGTCAGCGCTGTGACCCTGG - Exonic
1142722839 17:1788324-1788346 CAGGGCCTGCTCTGTCACCCAGG - Intronic
1142829663 17:2538973-2538995 CAGCCTGAGATCTGTCGCCCAGG - Intergenic
1142955359 17:3517842-3517864 GAGTTTTTGCTCTGTCACCCAGG + Intronic
1143604552 17:7974904-7974926 CAGTCTCAAATCTATCTCCCTGG + Intergenic
1143686431 17:8520468-8520490 GAGTCTTCGCTCTGTCACCCAGG - Intronic
1143775140 17:9194516-9194538 CAGTCTCAGCACTGTCGACCTGG + Intronic
1143800966 17:9380443-9380465 CAGGCCCTGCTATGTCACCCAGG + Intronic
1144239557 17:13296849-13296871 CAGCTTCAGCTCTGTGACCTTGG - Intergenic
1144426257 17:15145003-15145025 CGGAGTCCGCTCTGTCACCCAGG - Intergenic
1144526143 17:15991950-15991972 GAGTCTTGCCTCTGTCACCCAGG + Intronic
1144529156 17:16019305-16019327 GAGTCTTCACTCTGTCACCCAGG - Intronic
1144560767 17:16318903-16318925 CAGAATCCTCTCTGTCACCCAGG - Intronic
1144569531 17:16387375-16387397 GAGTCTCCGCTCTTTCACCCAGG - Intergenic
1144857091 17:18275376-18275398 GAGTCTTCGCTCTGTCACCCAGG + Intronic
1144876974 17:18403016-18403038 GAGTCTTAACTCTGTCACCCAGG + Intergenic
1144940364 17:18935212-18935234 AAGTTTTGGCTCTGTCACCCAGG + Intergenic
1145087417 17:19954004-19954026 GAGTCTCACTTCTGTCACCCAGG - Intronic
1145155256 17:20541392-20541414 GAGTCTTAACTCTGTCACCCAGG - Intergenic
1145855439 17:28152647-28152669 GGGACTCAACTCTGTCACCCAGG + Intronic
1146147437 17:30432890-30432912 GGGTCTCAGCTTTGTCACCCAGG - Intronic
1146307644 17:31742818-31742840 CAGTCTCACCTCTGTCACCCAGG - Intergenic
1146661799 17:34669802-34669824 AAGTCTCAGGTCTGTGACCTTGG - Intergenic
1146715635 17:35084566-35084588 CAGTCTCAGCTCTGTCATCCAGG - Intronic
1146807884 17:35879607-35879629 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
1146851828 17:36228641-36228663 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1146867738 17:36352514-36352536 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1147013669 17:37472834-37472856 TGGTCTTAACTCTGTCACCCAGG - Intronic
1147070612 17:37953131-37953153 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
1147082138 17:38032657-38032679 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1147098085 17:38156622-38156644 GAGTCTTCGCTCTGTCGCCCAGG + Intergenic
1147220275 17:38924769-38924791 CGATCTCAGCTCTGCCTCCCGGG + Intergenic
1147222451 17:38944674-38944696 CGGAGTCTGCTCTGTCACCCAGG - Intronic
1147270149 17:39263487-39263509 CAGGGTCTCCTCTGTCACCCAGG - Intronic
1147335375 17:39724333-39724355 CGGTCTCAGCTCAGCCTCCCAGG + Intronic
1147344523 17:39780387-39780409 GGGTCTCAACTCTGTTACCCAGG + Intronic
1147401883 17:40185259-40185281 CAGTGTAAACTCTGTCACCATGG + Intronic
1147421964 17:40326385-40326407 AAATCTCAGCTCTGCCACTCTGG - Intronic
1147437234 17:40424486-40424508 CAGTTTCAGCTCTGTTGCCCAGG + Intergenic
1147455853 17:40537617-40537639 CAGTCTCACTCTTGTCACCCAGG - Intergenic
1147613708 17:41816108-41816130 GAGTCTCGGCTCTGTCACCCAGG - Intronic
1147867741 17:43564580-43564602 CAGGGTCTTCTCTGTCACCCAGG - Intronic
1147913115 17:43869539-43869561 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1148014450 17:44511274-44511296 CTGGCTCTGCTCTGTCACCCAGG - Intergenic
1148045931 17:44744384-44744406 CAGGGTCTACTCTGTCACCCAGG - Intronic
1148197257 17:45722898-45722920 CAGTTTTCACTCTGTCACCCAGG - Intergenic
1148231419 17:45937563-45937585 GGGTCTCAGCTCTGTTGCCCAGG - Intronic
1148260695 17:46180470-46180492 GAGTCTCACTTTTGTCACCCAGG - Intronic
1148435578 17:47681856-47681878 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1148506239 17:48129513-48129535 TACTCTCCCCTCTGTCACCCAGG - Intergenic
1148522370 17:48291091-48291113 CAGGGTCTACTCTGTCACCCAGG - Intronic
1148706404 17:49637374-49637396 AAATCTCAGCTCTGTTAGCCAGG + Intronic
1148794009 17:50188619-50188641 CGGTCTCACCACGGTCACCCTGG + Exonic
1148937496 17:51175314-51175336 CAGTCTCGGCTCTGTCGCCCAGG + Intergenic
1149000883 17:51756490-51756512 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
1149004147 17:51787514-51787536 CACCCTCCTCTCTGTCACCCAGG + Intronic
1149033075 17:52105278-52105300 GAGTCTTGGCTCTGTCGCCCAGG + Intronic
1149105574 17:52960207-52960229 GAGTCTTGGCTCTGTTACCCAGG - Intergenic
1149474825 17:56951823-56951845 GAGTCCCAACTCCGTCACCCAGG + Intronic
1149497753 17:57130930-57130952 CAGTCTCAGTTCTGTCGCTGTGG + Intergenic
1149594512 17:57856437-57856459 GAGTCTCAGCTCTGTCACCCAGG - Intergenic
1149794611 17:59507801-59507823 AGGTCTTGGCTCTGTCACCCAGG + Intergenic
1149871141 17:60182936-60182958 CACTCTCAACTCTGTAAACCTGG + Intronic
1149885680 17:60337853-60337875 CCGTCTCATTTCTGTCTCCCAGG - Intronic
1150099777 17:62412488-62412510 GGGTCTCAACTTTGTCACCCAGG + Intronic
1150102236 17:62433712-62433734 AGGTCTCAGCTGTGTCACCCAGG - Intronic
1150113017 17:62518901-62518923 AGGTCTTGGCTCTGTCACCCAGG + Intronic
1150240487 17:63627929-63627951 GAGTCTCTACTCTGTCGCCCAGG + Intronic
1150336801 17:64336238-64336260 GGGTCTTCGCTCTGTCACCCAGG - Intronic
1150351824 17:64451167-64451189 GAGTCTCTGCTCTGTCGCCCAGG + Intronic
1150364804 17:64572932-64572954 CAGTCTCAATTATGTCACCAAGG - Intronic
1150487833 17:65556293-65556315 TAGTCTCAGCTCTGGCTGCCAGG + Intronic
1150827050 17:68486150-68486172 CAGTTTCACCTCAGTCACACTGG + Intergenic
1150913365 17:69411744-69411766 GAGTCCTCGCTCTGTCACCCAGG - Intergenic
1151125835 17:71843878-71843900 AAGTCTCACTTTTGTCACCCAGG + Intergenic
1151545400 17:74789977-74789999 GGGTCTTCGCTCTGTCACCCAGG + Intronic
1151608925 17:75158216-75158238 TACTTTCTGCTCTGTCACCCAGG - Intronic
1151750023 17:76031763-76031785 GAGTCTCACTTCTGTCATCCAGG - Intergenic
1151750778 17:76036364-76036386 CAGTCTCACTCTTGTCACCCAGG - Intergenic
1151833008 17:76566806-76566828 GGGTCTCAACTCTGTCACCCAGG - Intronic
1151914005 17:77104143-77104165 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1151951975 17:77359768-77359790 CAGGTCCTGCTCTGTCACCCAGG - Intronic
1152020793 17:77779322-77779344 CAGCCTGAGCTCTGCCAGCCTGG + Intergenic
1152059552 17:78060496-78060518 GAGTCTTAACTCTGTCGCCCAGG + Intronic
1152139504 17:78528284-78528306 GGGTCTTGGCTCTGTCACCCAGG + Intronic
1152201346 17:78948241-78948263 CAGAGTCTACTCTGTCACCCAGG - Intergenic
1152420926 17:80192776-80192798 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1152422151 17:80199534-80199556 AAGGCTTTGCTCTGTCACCCAGG - Intronic
1152748083 17:82050395-82050417 CACTCACAGTTCTGCCACCCTGG + Exonic
1152761714 17:82111630-82111652 CAGAGTCTGCTCTTTCACCCAGG + Intronic
1153297896 18:3565172-3565194 CAGAGTCTGCTCTGCCACCCAGG + Intronic
1153339571 18:3960534-3960556 GGGTCTCCGCTCTGTCACCCAGG - Intronic
1153469393 18:5427027-5427049 GGGTCTTTGCTCTGTCACCCAGG + Intronic
1153799724 18:8658604-8658626 GGGTCTCACTTCTGTCACCCAGG - Intergenic
1153828407 18:8898232-8898254 CAGGGTCTGCTCTGTCACCCAGG - Intergenic
1153849744 18:9082018-9082040 GGGTCTCAACTCTGTCACCCAGG + Intergenic
1153895994 18:9560834-9560856 GGGTCTCCGCTCTGTCACCCAGG - Intronic
1153933674 18:9901624-9901646 CTGGCTCAGCTCTGTCACCCAGG - Intergenic
1154059111 18:11042302-11042324 CTGTCACAGCTCAGTCACACAGG + Intronic
1154196268 18:12269721-12269743 CAGGGTTTGCTCTGTCACCCGGG + Intronic
1154298165 18:13168742-13168764 CAGAGTCTGCTCTGTCGCCCAGG - Intergenic
1154947515 18:21176904-21176926 CAGGGTTTGCTCTGTCACCCAGG + Intergenic
1154950791 18:21207645-21207667 GAGTCTCACTTGTGTCACCCAGG + Intergenic
1155156383 18:23161181-23161203 GAGTCTCCCCTCTGTCACCCAGG - Intronic
1155161347 18:23198232-23198254 CAGGGTTTGCTCTGTCACCCAGG - Intronic
1155480113 18:26277106-26277128 GGGTCTTAACTCTGTCACCCAGG + Intronic
1155503038 18:26505899-26505921 GGGTCTCACCTCTGTCACTCAGG + Intronic
1156098961 18:33570341-33570363 CGATCTCAGCTCCGTCTCCCGGG - Intergenic
1156185207 18:34654750-34654772 CAGAGTTTGCTCTGTCACCCAGG + Intronic
1156220870 18:35050848-35050870 CTGTTTCAGCCCTCTCACCCAGG + Intronic
1156381794 18:36568300-36568322 CAGAGTCTGCTCTGTCGCCCAGG - Intronic
1156549907 18:38004659-38004681 CTGTCACTGCTCTGTCACCTGGG - Intergenic
1156896709 18:42255065-42255087 CAATCTCAGCTCTGCCTCCCGGG + Intergenic
1157234478 18:45951482-45951504 CAGCCTCCACTCTGTCACCCAGG + Intronic
1157316997 18:46600570-46600592 GAGTTTCACTTCTGTCACCCAGG - Intronic
1157494572 18:48147101-48147123 CAGTCTCACTCTTGTCACCCAGG + Intronic
1157517675 18:48322220-48322242 CAATCTCAGCACTGACACTCTGG + Intronic
1157765547 18:50294286-50294308 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1157834091 18:50883183-50883205 CAGAATCAGTTGTGTCACCCAGG - Intronic
1157837345 18:50917943-50917965 CAGTCTCACTCTTGTCACCCAGG - Intronic
1157839686 18:50945141-50945163 GAGTCTCAACTCTGTCGCCCAGG + Intronic
1158457968 18:57624026-57624048 CAGTCTCAGTTCTGTCGCCCAGG + Intergenic
1158563490 18:58534967-58534989 CAGCCTCAGTGCTGCCACCCTGG + Exonic
1158585891 18:58734457-58734479 GGGTCTTAACTCTGTCACCCAGG + Intronic
1158586802 18:58746041-58746063 GAGTCTTAACTCTGTCACCCAGG + Intronic
1158714753 18:59868487-59868509 CAGTCCTCACTCTGTCACCCTGG + Intergenic
1159313234 18:66737461-66737483 CAGTCTCAACTCAGTCGTCCAGG + Intergenic
1159875753 18:73809169-73809191 CACTCTGAGCTCTGACACCCTGG + Intergenic
1159986347 18:74846363-74846385 CGGAATCTGCTCTGTCACCCAGG + Intronic
1160278279 18:77460659-77460681 GAGTCTCATCTCTGTCACCCAGG + Intergenic
1160801104 19:969711-969733 GAGTCTTCCCTCTGTCACCCAGG + Intronic
1160928455 19:1558337-1558359 AAGGCTTTGCTCTGTCACCCAGG - Intronic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161016291 19:1985397-1985419 CACTCTCTGCCCTGTCATCCGGG - Intergenic
1161188633 19:2940125-2940147 GGGTCTTTGCTCTGTCACCCAGG - Intronic
1161225261 19:3141776-3141798 GAGTCTCAGCTGTGTGACCTTGG - Intronic
1161260354 19:3334413-3334435 CAGGGTCCGATCTGTCACCCAGG + Intergenic
1161270422 19:3386679-3386701 CAGTCTCGGCTGTGTGACCACGG - Intronic
1161351340 19:3793674-3793696 GAGTCTCCACTCTGTCGCCCAGG - Intronic
1161376203 19:3940269-3940291 CAGTCTCAGCTCTGCCTCCCAGG - Intronic
1161382512 19:3973197-3973219 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161382671 19:3974269-3974291 CAGTCTTTGCTCTGTCACCCAGG - Intergenic
1161462975 19:4409817-4409839 CAGTCTCCACTGGGTCACCCAGG + Intronic
1161548884 19:4899604-4899626 CAGTCTTTACTCTGGCACCCAGG - Intronic
1161695581 19:5765784-5765806 GAGTTTTTGCTCTGTCACCCAGG - Intronic
1162004321 19:7767607-7767629 ACGGCTCACCTCTGTCACCCAGG + Exonic
1162051915 19:8039466-8039488 CAGACTCTGCTCTGTTGCCCAGG + Intronic
1162084688 19:8241338-8241360 CAGGATCTGCTCCGTCACCCAGG + Intronic
1162214440 19:9121500-9121522 CAGAGTCTGTTCTGTCACCCAGG - Intergenic
1162217210 19:9146450-9146472 GTGTCTCATTTCTGTCACCCAGG + Intronic
1162333811 19:10047558-10047580 CAGAGTTTGCTCTGTCACCCAGG + Intergenic
1162397025 19:10423182-10423204 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1162495439 19:11020863-11020885 GAGTCTCACAGCTGTCACCCAGG + Intronic
1162511104 19:11119013-11119035 GAGTCTCAACTCGGTCACCCAGG - Intronic
1162583914 19:11547366-11547388 GAGTCTTGGCTCTGTCACCCAGG - Intronic
1162677843 19:12313727-12313749 GAGTCTCACCCCTGTCGCCCAGG + Intergenic
1162815338 19:13190880-13190902 CAGTCTTAACTCTGTCACACAGG + Intergenic
1162905122 19:13818587-13818609 CAGTCTTCACTCTGTCACCCAGG + Intronic
1162991187 19:14303289-14303311 AAGTCTCGGCTCTGTCACCCAGG - Intergenic
1163274967 19:16277810-16277832 GAGTCTTTGCTCTGTCGCCCAGG + Intergenic
1163286971 19:16354852-16354874 GGGTCTGAGCTCTGTCACCCAGG - Intergenic
1163417735 19:17196655-17196677 GAGTCTCATCTCTGTCATCCAGG - Intronic
1163432718 19:17277851-17277873 GGGTCTCCGCCCTGTCACCCAGG - Intronic
1163471517 19:17500149-17500171 CATTCTAAGCTCTGTGACCTTGG - Intronic
1163592379 19:18201558-18201580 GAGTTTTTGCTCTGTCACCCAGG - Intronic
1163735125 19:18975190-18975212 AAGGCTTTGCTCTGTCACCCAGG - Intergenic
1163816671 19:19469919-19469941 CAGACGGAGCTCTGTCACCCAGG - Intronic
1164012661 19:21219070-21219092 GAGTCTCACGTTTGTCACCCAGG - Intergenic
1164224261 19:23228426-23228448 AAGTCTCATCTCTGTCACCCAGG - Intronic
1164947186 19:32305786-32305808 CAGAGTCTTCTCTGTCACCCAGG - Intergenic
1165006259 19:32809669-32809691 CAGTTTCATCCCTGTAACCCTGG + Intronic
1165061794 19:33208396-33208418 CAGTCTGAGCTCGGCCACCCAGG - Exonic
1165121145 19:33559641-33559663 CAGTCTCACTATTGTCACCCAGG + Intergenic
1165209904 19:34226034-34226056 CAGGCCTCGCTCTGTCACCCAGG - Intronic
1165542362 19:36502761-36502783 CAGTCTCAGTTTTTTCACACTGG + Intergenic
1165550282 19:36578088-36578110 GAGTCTTAACTCTGTCACCCAGG + Intronic
1165573215 19:36792585-36792607 CAGACCCTCCTCTGTCACCCCGG + Intergenic
1165652503 19:37503547-37503569 GAGTCTCTACTCTGTCTCCCAGG - Intergenic
1165658400 19:37553157-37553179 CAGTCTCGCCTTTGTCACCTAGG + Intronic
1165690299 19:37857828-37857850 CAGTCTTCACTCTGTCACCCAGG + Intergenic
1165693502 19:37882963-37882985 AAGTCTCCGCTCTGTCACCCAGG + Intergenic
1165697827 19:37914393-37914415 CAGGGTCTGCTCTGTCGCCCAGG + Intronic
1165840192 19:38784338-38784360 CAATCTCAGCTCTGCCTCCTGGG - Intergenic
1166120581 19:40684092-40684114 CAGAGTCTGCTCTGTCGCCCAGG + Intronic
1166212151 19:41313724-41313746 GAGTCTTCACTCTGTCACCCAGG + Intronic
1166289579 19:41853883-41853905 CCTTCTCAGCTCTGTGACCTTGG - Intergenic
1166614048 19:44227269-44227291 GTGTCTCACCCCTGTCACCCAGG + Intronic
1166694085 19:44842552-44842574 CAGTCTCTGCTCTGTCGCCCAGG - Intergenic
1166784610 19:45360104-45360126 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1167024058 19:46901530-46901552 GAGTCTAAGCTCTGTCACCCAGG - Intergenic
1167222404 19:48209268-48209290 GGGTCTCAACTCTGTTACCCAGG - Exonic
1167332247 19:48863454-48863476 GAGTCTTCGCTCTGTCACCCAGG + Intronic
1167338250 19:48899885-48899907 CAGGGTTTGCTCTGTCACCCAGG - Intergenic
1167338617 19:48901741-48901763 GAGTCTCAGCTCTGTTGCCCAGG - Intronic
1167505911 19:49871009-49871031 CAGTCCCAGCTCTGCCTCTCAGG + Intronic
1167551429 19:50163470-50163492 GAGTCTCAACTCTGTCACCCAGG + Intergenic
1167626013 19:50589849-50589871 GGGTCTCAACTCTGTCACCCAGG + Intergenic
1167748234 19:51365396-51365418 CAGTGTCAACTTTGTGACCCTGG + Intronic
1167800463 19:51737714-51737736 CAATCTCAGCTCTGCCCCCTGGG + Intergenic
1167859608 19:52271954-52271976 CAGTCTCACTCTTGTCACCCAGG - Intronic
1168024039 19:53630870-53630892 GAGTCTCACTCCTGTCACCCAGG + Intergenic
1168381965 19:55931681-55931703 GAGTCTCCACTCTGTCGCCCAGG - Intronic
1168505209 19:56928426-56928448 GAGTCTACGCTCTGTCATCCAGG + Intergenic
1168518765 19:57031828-57031850 CAATCTCAGCTCCGCCTCCCAGG + Intergenic
1168537929 19:57186848-57186870 GAGTCTCGGCACTGTCACCCGGG - Intergenic
1168558030 19:57360174-57360196 GAGTCTCCACTCTGTCACCCAGG + Intergenic
1168604969 19:57751385-57751407 AAGTCTTAACTCTGTCACCCAGG + Intronic
1168606842 19:57767152-57767174 CACTCTGTCCTCTGTCACCCCGG + Intergenic
925154059 2:1636996-1637018 CAGACCCAGCGCTGCCACCCAGG + Intronic
925368171 2:3325108-3325130 CAGTTGTAGCTCTGTCTCCCTGG - Intronic
925612663 2:5715670-5715692 CAGTGTAACCTCTGCCACCCAGG - Intergenic
925650172 2:6081097-6081119 CATTCCCAGCTCTGAGACCCTGG - Intergenic
925986259 2:9217638-9217660 GAGTCTTCGCTCTGCCACCCAGG + Intronic
926016941 2:9461785-9461807 GAGTCTCTGCTCTGTCGCCCAGG + Intronic
926109253 2:10171573-10171595 CAGCATCAGCTCTGTCTCACAGG - Intronic
926110705 2:10181788-10181810 GGGTCTCAGCTCTGTCACTCAGG + Intronic
926328023 2:11802143-11802165 TAGTATCAGCTCTGCCTCCCAGG - Intronic
926753533 2:16218476-16218498 GAATCTCAGCTCTGTCACCCAGG - Intergenic
926811322 2:16757487-16757509 CACACTCAGCTCTGTCACCATGG - Intergenic
927550214 2:23991815-23991837 CAGTCTCAACTCTGTTGCCTAGG + Intronic
927559312 2:24058172-24058194 GAGTCTCATCTCTGTCACCCAGG - Intronic
928082676 2:28324767-28324789 CTGTCTGCACTCTGTCACCCAGG - Intronic
928164947 2:28963979-28964001 GAGTTTTTGCTCTGTCACCCAGG - Intronic
928186779 2:29117367-29117389 CTCGCTCTGCTCTGTCACCCAGG + Intronic
928322225 2:30292881-30292903 GAGTCTCACTCCTGTCACCCAGG - Intronic
928352634 2:30574114-30574136 GAGTCTTGGCTCTGTTACCCAGG - Intronic
928502824 2:31915104-31915126 GAGTCTCAGCTCTGTTGCCCAGG - Intronic
928548792 2:32352214-32352236 CAGAGTCTCCTCTGTCACCCAGG + Intergenic
928572598 2:32624176-32624198 GAGCCTCGGCTCTGTCGCCCAGG + Intergenic
928630826 2:33189999-33190021 GAGTCTCACTCCTGTCACCCAGG - Intronic
929115487 2:38440544-38440566 CACTGTCAGCTCTGCCTCCCGGG - Intergenic
929120310 2:38478759-38478781 GAGTCTCGCCTCTGTCACCCAGG - Intergenic
929470119 2:42183127-42183149 CAGTCACCACTCCGTCACCCAGG - Intronic
929493168 2:42415703-42415725 CAGAGTCTACTCTGTCACCCAGG - Intronic
929641978 2:43590567-43590589 CACTGTCAGCTCTGCCTCCCGGG - Intronic
929737390 2:44564612-44564634 CGATCTCAGCTCAGTCTCCCAGG + Intronic
930584449 2:53252992-53253014 GGGTCTCAATTCTGTCACCCAGG + Intergenic
930662692 2:54070760-54070782 GGGTCTCAGCTCTGTCACCCAGG + Intronic
930675678 2:54198043-54198065 CAGTTTCACTTTTGTCACCCAGG + Intronic
930676796 2:54210113-54210135 CAGTCTCATTCTTGTCACCCAGG - Intronic
931256367 2:60577295-60577317 GAGTCTTTACTCTGTCACCCAGG - Intergenic
931285608 2:60829251-60829273 CAGGATCTGCTCTGTCACCTAGG + Intergenic
931354736 2:61526731-61526753 GAGTCTTGGCTCTATCACCCAGG + Intronic
931354832 2:61527460-61527482 GGGTCTCTGCTCTTTCACCCAGG - Intronic
931373206 2:61683356-61683378 CAGTTCTTGCTCTGTCACCCAGG - Intergenic
931437410 2:62260645-62260667 GGGTCTTAACTCTGTCACCCAGG - Intergenic
931518976 2:63074297-63074319 CAGGTTTTGCTCTGTCACCCAGG - Intergenic
931792176 2:65673936-65673958 CAGTCTCTGTTCTGTTGCCCAGG + Intergenic
931811187 2:65856583-65856605 CAGTCTCAGCTGTATGACCTAGG - Intergenic
931944844 2:67294800-67294822 GAGTCTCAACTCTGTCGCCCAGG + Intergenic
932267634 2:70382046-70382068 CAGTGTCAGCTCGATCCCCCAGG - Intergenic
932319155 2:70808418-70808440 CAGTCCTAGCTCTGTCGCCCAGG - Intergenic
932392580 2:71410205-71410227 AAGTCTTAACTCTGTCACCTGGG + Intronic
932538275 2:72622682-72622704 GGGTCTGGGCTCTGTCACCCAGG - Intronic
932608734 2:73182727-73182749 CACTCTGCACTCTGTCACCCAGG - Intergenic
933063826 2:77769837-77769859 GAGTTCCTGCTCTGTCACCCAGG - Intergenic
933195286 2:79382637-79382659 CACTCTTCGCTCTGTCGCCCAGG + Intronic
933502904 2:83139456-83139478 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
933509839 2:83226305-83226327 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
933669802 2:84996459-84996481 GAGTCTTGGCTCTGTCACCCAGG + Intronic
933671353 2:85010441-85010463 CAGTCTCAATTTGGTCACCCAGG - Intronic
933683512 2:85124420-85124442 GAGTCTTTGCTCTGTCTCCCAGG + Intergenic
933873121 2:86589599-86589621 GAGTCTTGGCTCTGTCACCCAGG + Intronic
933910840 2:86940321-86940343 CAGAGTCTGCTCTGTCACCCAGG + Intronic
934021888 2:87963089-87963111 CAGAGTCTGCTCTGTCACCCAGG - Intergenic
934505720 2:94891567-94891589 GAGTCTCAACTTTGTCACCCAGG - Intergenic
934652866 2:96102325-96102347 GAGTCTTCGCTCTGTCACCCAGG + Intergenic
934712538 2:96525434-96525456 CAGACTTAGGTCTGTCACTCAGG - Intergenic
934723495 2:96598882-96598904 CAGTCTCACTCTTGTCACCCAGG - Intronic
935035787 2:99371460-99371482 GAGTCTTTGCTCTGTCGCCCAGG - Intronic
935136948 2:100313769-100313791 CATTCTCACCTCTGTCACTTTGG + Intronic
935231851 2:101105561-101105583 CAGAGTCTGGTCTGTCACCCAGG - Intronic
935661495 2:105470697-105470719 CTGTCTCCTTTCTGTCACCCAGG + Intergenic
935701542 2:105816278-105816300 CAGGGTCTCCTCTGTCACCCAGG - Intronic
936762734 2:115805598-115805620 CAGTCTCACTCCTGTCGCCCAGG + Intronic
936849830 2:116882309-116882331 AAATCTCAGCTCTTACACCCTGG + Intergenic
937056517 2:118941915-118941937 CAGACTCAGCTCTCTGTCCCAGG - Intergenic
937313210 2:120914890-120914912 CAGCCTCAGCTCTGTCCAACAGG + Intronic
937366919 2:121269420-121269442 GGGTCTCACCTCTGTCACCCAGG - Intronic
938182986 2:129200932-129200954 CAGTCTCACTCTTGTCACCCAGG - Intergenic
938649246 2:133364778-133364800 GAGTCTCAATACTGTCACCCAGG + Intronic
938827345 2:135019051-135019073 GAGTCTCACTTCTGTCACCCAGG - Intronic
938831632 2:135055650-135055672 GGGTCTCAACTCTGTCACCCAGG - Intronic
939195229 2:138963206-138963228 GAATCTCTGCTCTGTCACCCAGG + Intergenic
939402492 2:141712351-141712373 GGGTCTCAGTTCTGTCACCCAGG - Intronic
939498611 2:142952466-142952488 CAGGTTCCACTCTGTCACCCAGG + Intronic
939592405 2:144081911-144081933 GAGTCTCACTCCTGTCACCCAGG + Intronic
939952980 2:148497757-148497779 AGGTCTCCACTCTGTCACCCAGG - Intronic
940188203 2:151010166-151010188 GAGTCTCGGCTCTGTCCCCCAGG + Intronic
940375662 2:152955257-152955279 GAGTCTTAACTCTGTCACCCAGG - Intergenic
940656349 2:156491942-156491964 CACTCCAACCTCTGTCACCCGGG - Intronic
940785147 2:157972829-157972851 CTCTGTCAGCTCTGTCACCCAGG + Intronic
940916860 2:159265680-159265702 CAGGGTCTCCTCTGTCACCCAGG - Intronic
940956786 2:159737760-159737782 GGGTCTCAGCTCTGTTGCCCAGG - Intronic
941724845 2:168849939-168849961 CAGTTTCACTTTTGTCACCCAGG + Intronic
941882163 2:170492025-170492047 GAGTCTCATCTCTGTCACCCAGG - Intronic
941968229 2:171321986-171322008 CAGTCTAACAACTGTCACCCAGG + Exonic
942035947 2:172010772-172010794 AAGTCTCTGATCTTTCACCCAGG + Intronic
942457921 2:176150735-176150757 CAGTCCCAGCTCTGCCCTCCAGG + Intergenic
942547097 2:177076528-177076550 CAGGGTAAGCTCTCTCACCCAGG + Intergenic
942574050 2:177344009-177344031 GTGTCTCTGCTCTGTCACCCAGG - Intronic
942771456 2:179526061-179526083 CAGTGTCTCTTCTGTCACCCAGG + Intronic
943057796 2:183004856-183004878 GAGTCTCATCTCTGTCACCCAGG - Intronic
943268930 2:185772884-185772906 CAGATCTAGCTCTGTCACCCAGG + Intronic
943337609 2:186637453-186637475 GGGTCTCGGCTCTGTCGCCCGGG - Intronic
943934185 2:193893953-193893975 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
944086079 2:195849625-195849647 GAATCTTAACTCTGTCACCCAGG + Intronic
944087187 2:195863008-195863030 CAGTCTCACTCTTGTCACCCTGG - Intronic
944265279 2:197717694-197717716 AAGTCTCAGCCTTGTCCCCCAGG - Intronic
944391191 2:199221622-199221644 AGGTCTTAGCTCTGTCACCCAGG + Intergenic
944807765 2:203299007-203299029 AGGTCTCAGCCCTGTCGCCCAGG - Intronic
945567141 2:211414468-211414490 GTGTCTTGGCTCTGTCACCCAGG - Intronic
945878261 2:215300783-215300805 CAGAGTCTACTCTGTCACCCAGG + Intergenic
946058399 2:216920457-216920479 CAGTCTCTGATATGTCCCCCAGG - Intergenic
946062743 2:216958478-216958500 AAGTCTCAACTCTATCCCCCAGG - Intergenic
946186283 2:217982427-217982449 CTTGCTCTGCTCTGTCACCCAGG + Intronic
946235357 2:218321652-218321674 GAGTCTCACCCCTGTCACCTAGG + Intronic
946663576 2:222026915-222026937 CAGGGTCCACTCTGTCACCCAGG - Intergenic
946920628 2:224577541-224577563 GAGTCTCCGCTCTGTCACCCAGG - Intronic
946954418 2:224912998-224913020 GAGTCTTTCCTCTGTCACCCAGG - Intronic
947228009 2:227858612-227858634 GAGTCTCGGCTCTGTCACCCAGG + Intergenic
947305884 2:228746717-228746739 GAGTCTCACTTCTGTCACCCAGG + Intergenic
947417831 2:229916527-229916549 GAGTCTCACTTTTGTCACCCAGG - Intronic
947487717 2:230567656-230567678 CAGGGTCTTCTCTGTCACCCAGG - Intergenic
947687194 2:232098377-232098399 CAGAGTCTACTCTGTCACCCAGG + Intronic
947880808 2:233509813-233509835 GAGTCTCAACTCTGTCACCCAGG - Intronic
948073138 2:235143688-235143710 GAGTCTCACCCTTGTCACCCAGG - Intergenic
948126108 2:235565684-235565706 CAGGGTCGGCTCTGTCACCCGGG + Intronic
948204531 2:236156275-236156297 CAGTGTCAGCTGTGAAACCCGGG + Intergenic
948216263 2:236235730-236235752 GGGTCTCAACTCTGTCACCCAGG + Intronic
948587276 2:239027307-239027329 CAAACTCAGCTCTGTGACCTGGG - Intergenic
948630833 2:239301506-239301528 GGGTCTCCCCTCTGTCACCCAGG + Intronic
948793361 2:240390425-240390447 CGGCCTCAGCACTGCCACCCAGG + Intergenic
948850408 2:240702793-240702815 CAGGCTCAGGACTGCCACCCAGG + Intergenic
1168770831 20:415340-415362 GGGTCTCACTTCTGTCACCCAGG - Intronic
1168779320 20:475432-475454 GAGTCTTAACTCTGTCACCCAGG - Intronic
1168854466 20:999009-999031 CAGGGTCTGCTCTGTCGCCCAGG + Intronic
1168889962 20:1288645-1288667 GAGTCTCCACTCTGTCGCCCAGG + Intronic
1169348008 20:4844737-4844759 CAGGCCTTGCTCTGTCACCCAGG - Intergenic
1169383279 20:5127088-5127110 CTGCCTCAGCTCTGTCATCCTGG - Exonic
1169430609 20:5532763-5532785 CAGAGTCTGCTCTGTCACCAAGG - Intergenic
1169449532 20:5699823-5699845 CAGTCTCATTTCTGTCACCCAGG + Intergenic
1169783926 20:9338649-9338671 GAGTCTCTGCTCTGTCACCCAGG - Intronic
1170234531 20:14087368-14087390 TGGTCTCAATTCTGTCACCCAGG - Intronic
1170303190 20:14908635-14908657 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1170498958 20:16954923-16954945 TAGTCTCAGCTGTGTGACCTTGG + Intergenic
1170878971 20:20277942-20277964 CAGTGTCAGCTGTGTCACCCTGG + Intronic
1171364275 20:24613199-24613221 CATTCCCAGCTATGTGACCCTGG + Intronic
1171501354 20:25595981-25596003 CAGTGTCTCCTCTGTCACCCAGG + Intergenic
1171893315 20:30737054-30737076 GAGTCTCAACTTTGTCACCCAGG - Intergenic
1171967278 20:31540084-31540106 AAGTCTCAGCTGTGTAACCCTGG - Intronic
1172076819 20:32305120-32305142 GAGTCTCCCCTCTGTCCCCCAGG - Intronic
1172251304 20:33481135-33481157 CAGAGTCCACTCTGTCACCCAGG + Intergenic
1172283032 20:33721380-33721402 GAGTCTCGGATCTATCACCCAGG + Intergenic
1172297466 20:33823395-33823417 GGATCTCAGCTCTGTCGCCCAGG + Intronic
1172406514 20:34693831-34693853 CGGAGTCTGCTCTGTCACCCAGG + Intergenic
1172449957 20:35015022-35015044 GTGTCTTTGCTCTGTCACCCAGG + Intronic
1172495087 20:35375921-35375943 AAGGTCCAGCTCTGTCACCCAGG - Intronic
1172687350 20:36766166-36766188 GAGTCGCGGCTCTGTCACCCAGG - Intronic
1172719795 20:36990991-36991013 GAGTCTCAGTCTTGTCACCCAGG + Intergenic
1172738135 20:37144269-37144291 GGGTCTTAACTCTGTCACCCAGG - Intronic
1173218028 20:41105521-41105543 ATGTCTTCGCTCTGTCACCCAGG + Intronic
1173612872 20:44383575-44383597 GAGTCTCAACTCTCTCCCCCAGG + Intronic
1173623330 20:44453095-44453117 AAGTCTCGGCTCTGTCACCCAGG + Intronic
1173769273 20:45644366-45644388 GGGCCTCAGTTCTGTCACCCAGG + Intergenic
1173899649 20:46578025-46578047 GAGTCTCGTCTCTGTCGCCCAGG + Intronic
1173950809 20:46991940-46991962 GAGTCTCACGTCTGTCGCCCAGG - Intronic
1173971107 20:47152904-47152926 GAGTCTCAACTGTGTCACCCAGG - Intronic
1173980044 20:47216779-47216801 GAGTCTTTGCTCTGTCGCCCAGG - Intronic
1173992165 20:47311842-47311864 GAGTCTCACTTTTGTCACCCAGG - Intronic
1174029285 20:47608611-47608633 GGGTCTCAGCTCTGTCACCCAGG - Intronic
1174165000 20:48578199-48578221 CAGTTTGAGCTCCGTGACCCTGG + Intergenic
1174231813 20:49051515-49051537 GGGTCTTTGCTCTGTCACCCAGG - Intronic
1174286601 20:49478518-49478540 CAGTGTCAGCTCAGTCTCCCTGG + Intronic
1174407542 20:50311952-50311974 CTGGCTCTGCTCTGTGACCCTGG + Intergenic
1174621102 20:51875333-51875355 GAGTCTCAACTCTGTCTCCCAGG + Intergenic
1174800738 20:53561024-53561046 CTTGCTCTGCTCTGTCACCCAGG - Intergenic
1174807180 20:53614969-53614991 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1174854956 20:54035323-54035345 CAGTGCAAGCTCTGTCTCCCGGG - Intronic
1175006469 20:55688516-55688538 GAGTCTTTGCTCTGTCACCCAGG - Intergenic
1175066519 20:56293676-56293698 AGGTCTGGGCTCTGTCACCCAGG - Intergenic
1175488715 20:59364344-59364366 CAGACTCTGCTAAGTCACCCTGG + Intergenic
1175603641 20:60295244-60295266 GAGTCTCATTCCTGTCACCCAGG - Intergenic
1176268371 20:64222470-64222492 CACCCTCAACTCTGTCAGCCTGG + Intronic
1176316302 21:5247849-5247871 CAGAGTCTCCTCTGTCACCCAGG + Intergenic
1176361721 21:6002304-6002326 CAGTCTTAACTCTGTCGCCCAGG + Intergenic
1176620441 21:9054314-9054336 GAGTCTCAACTTTGTCACCCAGG + Intergenic
1177144762 21:17395518-17395540 GAGTCTTGGCTCTGTTACCCAGG + Intergenic
1177202483 21:17973440-17973462 CAGTCTCACTCTTGTCACCCAGG + Intronic
1177328655 21:19628084-19628106 CTCGCTCTGCTCTGTCACCCAGG - Intergenic
1177547704 21:22580246-22580268 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
1177800730 21:25826117-25826139 GAGTCTCACCTCTGTTGCCCAGG + Intergenic
1177997395 21:28117819-28117841 GAGTCTCTTCTCTGTCGCCCAGG - Intergenic
1178348970 21:31857852-31857874 CAGAGTCTGCTCTGTCACCCAGG + Intergenic
1178479682 21:32968764-32968786 AAGTCTCGGCTCTGTCGCCCAGG + Intergenic
1178533863 21:33396768-33396790 CAGAGTCTGCTCTATCACCCAGG + Intergenic
1178593938 21:33936048-33936070 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1178749327 21:35285474-35285496 GAGTCTTCGCTCTGTCACCCAGG - Intronic
1179052365 21:37898554-37898576 GAGTCTTTGCTCTGTCAGCCAGG - Intronic
1179400335 21:41077039-41077061 CTCACTCTGCTCTGTCACCCAGG + Intergenic
1179539486 21:42074925-42074947 GAGTCTTCACTCTGTCACCCAGG + Intronic
1179636147 21:42710959-42710981 CAGCTTTTGCTCTGTCACCCAGG - Intronic
1179676645 21:42987642-42987664 GAGTCTTCGCTCTTTCACCCGGG + Intronic
1179761797 21:43536246-43536268 CAGTCTTAACTCTGTCGCCCAGG - Intronic
1179782131 21:43708144-43708166 CAGGGTCTGCTCTGTCACCTGGG - Intergenic
1180431925 22:15261172-15261194 CGGAGTCTGCTCTGTCACCCAGG + Intergenic
1180670053 22:17546024-17546046 GAGTTTCAACTCTGTCGCCCAGG - Intronic
1180696552 22:17754788-17754810 GAGTCTCACCTGTGTAACCCAGG + Intronic
1180881331 22:19205482-19205504 CAGGGTCTCCTCTGTCACCCAGG - Intronic
1180892731 22:19302157-19302179 GAGTCTTCGCTCTGTCTCCCAGG + Intergenic
1181364995 22:22369604-22369626 CAGCCCCAGCTCTGGCACCAGGG + Intergenic
1181550084 22:23632887-23632909 CAGTTGCACCTTTGTCACCCAGG - Intergenic
1181632448 22:24158256-24158278 CTGTGTCAGCTCAGGCACCCAGG + Intronic
1181798300 22:25326652-25326674 GAGTTTCAACCCTGTCACCCAGG + Intergenic
1182313537 22:29426720-29426742 CAGAGTCTGCTCTATCACCCTGG - Intergenic
1182386327 22:29945036-29945058 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1182499445 22:30735439-30735461 GGGTCTTAACTCTGTCACCCAGG + Intronic
1182507764 22:30797306-30797328 AAGTCTCCGCCCTGTCACCCAGG + Intronic
1182600712 22:31461463-31461485 GAGTCTCAACTCTGTCTCCCAGG + Intronic
1182604701 22:31494107-31494129 CAGTTTCACTTTTGTCACCCAGG - Intronic
1182625674 22:31644263-31644285 GAGTCTTCACTCTGTCACCCAGG + Intronic
1183212776 22:36461231-36461253 CAGTCTGTACTCTGTCACCATGG + Intergenic
1183251770 22:36735326-36735348 GAGACTCACCTCTGTAACCCTGG - Intergenic
1183402594 22:37613424-37613446 GAGTCCCAGCTCTGTCACCCAGG + Intronic
1183449232 22:37882279-37882301 CAGTCTCATCTCTGTCACAAAGG - Intronic
1183552520 22:38498984-38499006 GAGTCTCAACGTTGTCACCCAGG - Intronic
1183565029 22:38608300-38608322 CAGGGTTTGCTCTGTCACCCAGG - Intronic
1183615438 22:38942394-38942416 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1183886709 22:40889801-40889823 CAGTGTTTGCTCTGTCACCAAGG - Intronic
1183980468 22:41536840-41536862 CAGAGTCTTCTCTGTCACCCAGG - Intronic
1184211762 22:43040260-43040282 CAGTCTCACCTCACTTACCCTGG - Intronic
1184214114 22:43055047-43055069 GAATCTTAACTCTGTCACCCAGG + Intronic
1184326480 22:43791345-43791367 CAGTCTCACTTCTATCACCCAGG - Intronic
1184462533 22:44647416-44647438 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
1184463509 22:44654939-44654961 AGGTCTCAACTCTGTCACCCAGG - Intergenic
1184601754 22:45548072-45548094 CAGAGACAGCTCTGTCACCCAGG + Intronic
1184608017 22:45585586-45585608 GAGACACAGCCCTGTCACCCCGG + Intronic
1184716906 22:46287671-46287693 CAGGCTCAGCAGAGTCACCCTGG + Intronic
1185361690 22:50411725-50411747 CAGTCTCCCCTTTGTCGCCCAGG - Intronic
949271805 3:2225485-2225507 GAGTCTCAGCTCTGTTGTCCAGG - Intronic
949364829 3:3269453-3269475 CAGAGTCTTCTCTGTCACCCAGG - Intergenic
949734763 3:7159426-7159448 CAGGCTCATCTCTTTCACTCTGG - Intronic
950057502 3:10038604-10038626 GAGTCTTGGCTCTGTCACCCAGG + Intronic
950059970 3:10062734-10062756 GAGTCTCAACTCTGTCGCCAAGG + Intronic
950062180 3:10080743-10080765 AAGGTTCTGCTCTGTCACCCAGG - Intronic
950106950 3:10394449-10394471 CACTCACAGCTGTGTGACCCTGG - Intronic
950160600 3:10757920-10757942 CAGACCCAGCTGTGTGACCCTGG - Intergenic
950180790 3:10911792-10911814 CGGCCTCAGCTGTGTGACCCTGG - Intronic
950283027 3:11723095-11723117 GAGACTCAGCTCTGTCGCCTAGG - Intergenic
950301326 3:11881957-11881979 GAGTCTCAACTCTGCCACCCAGG + Intergenic
950404128 3:12794079-12794101 CAGGCTCACCTCTGCCTCCCAGG + Intergenic
950546872 3:13643316-13643338 AAGGTCCAGCTCTGTCACCCAGG - Intergenic
950712853 3:14825621-14825643 CAGGGTCTGCTCTGTCAGCCAGG - Intronic
950891634 3:16409541-16409563 CAGTCTCACTCTTGTCACCCAGG + Intronic
950995523 3:17492458-17492480 CAGAGTCTCCTCTGTCACCCAGG + Intronic
951542254 3:23792850-23792872 TGGTGTCTGCTCTGTCACCCAGG - Intergenic
951770490 3:26250694-26250716 AAATCACAGCTCTCTCACCCAGG - Intergenic
951886510 3:27529859-27529881 GAGTCTCACTTTTGTCACCCAGG - Intergenic
951892344 3:27579040-27579062 GAGTCCCCACTCTGTCACCCAGG - Intergenic
951892960 3:27584038-27584060 GAATCTCGTCTCTGTCACCCAGG + Intergenic
952265693 3:31784335-31784357 CTTTCCCATCTCTGTCACCCAGG - Intronic
952301905 3:32110889-32110911 CAGAGTCAGCTCTGTTACCCAGG + Intronic
952722082 3:36544193-36544215 AGGTCTCAGCTTTGCCACCCAGG + Intronic
952761108 3:36914975-36914997 GAGTCTCATCTCTGTCACCCAGG + Intronic
952819296 3:37472026-37472048 GAGTCTCAGTTCTGTCACCCAGG - Intronic
952841666 3:37651854-37651876 CCTCCTCACCTCTGTCACCCTGG - Intronic
953046379 3:39297237-39297259 CAGTCTCACCCTTGTCCCCCAGG + Intergenic
953058733 3:39409056-39409078 GAGTCTCGGCTCTGTCACCCAGG - Intronic
953335893 3:42093726-42093748 GAGTCTCACTTCTATCACCCAGG + Intronic
953689122 3:45102696-45102718 CTCTGTCAACTCTGTCACCCAGG + Intronic
953973501 3:47365079-47365101 GAGTCTCGGATCTGTCACCCAGG - Intergenic
954019572 3:47727479-47727501 TAGTCTTTGTTCTGTCACCCAGG - Intronic
954028409 3:47801292-47801314 GAGTCTCTACTCAGTCACCCAGG - Intergenic
954047836 3:47948257-47948279 GGGTCTCAGCTCTGTTGCCCAGG + Intronic
954055433 3:48019691-48019713 CAGTCTCAACTGTGTTGCCCAGG - Intronic
954076489 3:48185597-48185619 AGGTCTCAACTCTGTCACCCAGG - Intronic
954119338 3:48486892-48486914 GAGTCTTGTCTCTGTCACCCAGG - Intronic
954207464 3:49070928-49070950 CAGAGTCTGCTCTGTCACCCAGG + Intronic
954266758 3:49475720-49475742 CGGAGTCTGCTCTGTCACCCAGG + Intronic
954520216 3:51218406-51218428 CAGATTCTGCTCTGTCACACAGG - Intronic
954621841 3:52000908-52000930 CAGTCACAGCTCTGTCTTCTAGG - Intergenic
955225901 3:57060273-57060295 GAATCTCAGCTCTGTCGCCCAGG - Intronic
955359361 3:58259653-58259675 GAGTCTCATCTCTGTCACCCAGG - Intronic
955947224 3:64206923-64206945 CAGGGTCTGCTCTGTCACCCAGG + Intronic
956408225 3:68950835-68950857 GAGTTTTTGCTCTGTCACCCAGG - Intergenic
956535017 3:70266444-70266466 GGGTCTCATTTCTGTCACCCAGG + Intergenic
956625101 3:71259116-71259138 CAGTCTTAGCTCTGTCACCCAGG - Intronic
956738578 3:72257846-72257868 CTGTCTCAGCTGGGTCAGCCTGG + Intergenic
957572857 3:81970250-81970272 CAGTCTCACTCTTGTCACCCAGG - Intergenic
958644824 3:96856212-96856234 CAGGGTCTCCTCTGTCACCCAGG - Intronic
958996209 3:100908088-100908110 GAGTCTTTGCTCTGTCACCCAGG - Intronic
959004084 3:100999552-100999574 CAATCTCAGCTCTGTTACTGAGG + Intergenic
959684552 3:109130262-109130284 GAGTCTCAGCTCTGTCGCCCAGG - Intergenic
960588682 3:119345008-119345030 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
960605056 3:119496696-119496718 CAGTCTTAGCTTCGTCACCCAGG - Intergenic
960609611 3:119543480-119543502 CAGTCTTTGCTCTGTCACCAAGG + Intronic
960834397 3:121890092-121890114 GAGTCTCTGCTCTGTCGCCCAGG + Intergenic
960834453 3:121890603-121890625 GAGTCTCTGCTCTGTCGCCCAGG - Intergenic
960877446 3:122311283-122311305 CATGCTCAGCTCTCTCATCCAGG - Intergenic
961046110 3:123709164-123709186 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
961110642 3:124280348-124280370 CAGTCCCATCTCTGTCTCCCAGG + Intronic
961766442 3:129215087-129215109 GAGTCTTCGCTCTGTCTCCCAGG - Intergenic
961843163 3:129735621-129735643 GAGTCTTGGCTCTGTCGCCCAGG - Intronic
961951512 3:130754414-130754436 GGGTCTCACATCTGTCACCCAGG + Intergenic
962132161 3:132692588-132692610 CAGGGTCTTCTCTGTCACCCAGG - Intronic
963722287 3:148876400-148876422 CAGAGTCTCCTCTGTCACCCAGG + Intronic
963899543 3:150720667-150720689 CAGTCTTTGTTCTGTCAGCCAGG + Intergenic
963928572 3:150977958-150977980 CACTCTAAGCTCTGCCTCCCGGG - Intergenic
964084402 3:152798789-152798811 CTCTGTCACCTCTGTCACCCAGG + Intergenic
964104286 3:153022455-153022477 GGGTCTCTTCTCTGTCACCCAGG - Intergenic
964547820 3:157854677-157854699 CAGAGTCTGCTCTGTCACCCAGG + Intergenic
964584905 3:158286850-158286872 CACTTTTCGCTCTGTCACCCAGG + Intronic
964854460 3:161131430-161131452 CTTTGTCTGCTCTGTCACCCAGG + Intronic
965078642 3:164009557-164009579 GAGTCTTGGCTCTGTCACCCAGG - Intergenic
965390591 3:168098028-168098050 GAGTCTCACCTCTGTCGCCCAGG - Intergenic
965602960 3:170472739-170472761 GAGTCTTCACTCTGTCACCCAGG - Intronic
965685819 3:171301338-171301360 GAGTCTCAGCTCTGTCATCTAGG + Intronic
965988501 3:174786423-174786445 CAGAGTCTGCTCTGTCACCCAGG - Intronic
966162977 3:176987180-176987202 CATTGTAACCTCTGTCACCCAGG - Intergenic
966390260 3:179445308-179445330 CAGGGTCTCCTCTGTCACCCAGG + Intronic
966419284 3:179721536-179721558 CTATCTCAGCTCTGTCATGCAGG + Exonic
966605378 3:181816067-181816089 GAGTCTCACCCTTGTCACCCAGG - Intergenic
966793264 3:183692191-183692213 GAGTCTTCGCTCTGTCGCCCAGG - Intergenic
966799265 3:183747803-183747825 GGGTCTTCGCTCTGTCACCCAGG + Intronic
966981136 3:185136696-185136718 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
967178527 3:186883739-186883761 GATTCTCCACTCTGTCACCCAGG + Intergenic
967418350 3:189244391-189244413 GAGTCTCATCTCTGTCACCCAGG - Intronic
967637387 3:191819094-191819116 AAGTCTGAGCTCTGTCCCCCAGG - Intergenic
967994131 3:195154018-195154040 TAGTCCCAGCTCTGCCACCTTGG - Intronic
968146224 3:196301031-196301053 GAGTCTCAACTCTGTTGCCCAGG - Intronic
968166335 3:196468301-196468323 GAGTCTCCAGTCTGTCACCCAGG + Intergenic
968484242 4:851121-851143 GGGTCTCCACTCTGTCACCCAGG + Intronic
968673099 4:1862809-1862831 CAGTCCCAGCCCTGCCGCCCTGG + Intergenic
968799025 4:2729929-2729951 GGGTCTCACCTTTGTCACCCAGG + Intronic
968816016 4:2822393-2822415 CAGTCTCACTCTTGTCACCCAGG + Intronic
969801842 4:9573560-9573582 CACTCTAAGCTCTGCCTCCCAGG + Intergenic
969941499 4:10736575-10736597 CAGCCTCAGCTCTTTCATCAAGG + Intergenic
970186474 4:13459838-13459860 CAGTTTCAGCTCTGTCCCAGAGG - Intronic
970276818 4:14409618-14409640 GAGTCCCTGCTCTGTCACTCAGG - Intergenic
970396054 4:15666793-15666815 AGGTAGCAGCTCTGTCACCCAGG - Intronic
970401376 4:15720763-15720785 CAGGTCCTGCTCTGTCACCCAGG - Intronic
971068805 4:23066791-23066813 GAGTCTCAACTCTGTCACCCAGG - Intergenic
971169799 4:24221745-24221767 GAGGGTCTGCTCTGTCACCCAGG - Intergenic
971191925 4:24436582-24436604 CGATGTCAGCTCTGTGACCCGGG - Intergenic
971191951 4:24436699-24436721 CGATGTCAGCTCTGTGACCCGGG - Intergenic
971191960 4:24436738-24436760 CGATGTCAGCTCTGTGACCCGGG - Intergenic
971191969 4:24436777-24436799 CGATGTCAGCTCTGTGACCCGGG - Intergenic
971191979 4:24436816-24436838 CGATGTCAGCTCTGTGACCCGGG - Intergenic
971219610 4:24692703-24692725 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
971249259 4:24958997-24959019 GAGCCACAGCTCTGTCGCCCAGG + Intronic
971284939 4:25279920-25279942 CAGAATCTACTCTGTCACCCAGG - Intergenic
971410917 4:26371002-26371024 CACTGCCAGCTCTGTCTCCCAGG - Intronic
972153520 4:36126861-36126883 GGGTCTCAGCCCTGTCACCCAGG + Intronic
972468940 4:39385207-39385229 CTTGCTCAGCTCTGTCACCCAGG + Intergenic
972522036 4:39868184-39868206 CTCTATCTGCTCTGTCACCCAGG + Intronic
972529875 4:39951872-39951894 CAGACTCTGCTCTGTCACCCAGG - Intronic
972588479 4:40460860-40460882 GAGTCTTAACTCTGTCACCCAGG - Intronic
972593137 4:40506980-40507002 CAGATTCTGCTCTGTCGCCCAGG + Intronic
972619167 4:40730302-40730324 CAAAGTCCGCTCTGTCACCCAGG - Intergenic
973234211 4:47880398-47880420 GGATCTCAGTTCTGTCACCCAGG - Intronic
973768761 4:54187846-54187868 CAGAGTCTGCTCTGTGACCCAGG - Intronic
973940578 4:55905995-55906017 ATCTCTCAGCTCTGTTACCCAGG + Intergenic
973991117 4:56408406-56408428 GAGTCTCCGCTCTGTCGCCCAGG - Intronic
974007346 4:56571817-56571839 CAGGTCCCGCTCTGTCACCCAGG - Intronic
974057742 4:57001232-57001254 CAATCTCAGCTCTGCCTCCTGGG + Intronic
974083634 4:57237215-57237237 CACTTTTAGCTCTGTGACCCTGG - Intergenic
974274965 4:59707538-59707560 CAGACTCAGGTCTGTCGCTCTGG - Intergenic
974334127 4:60518023-60518045 GGGTCTCAGCTCTGTCACCAAGG - Intergenic
974856406 4:67466325-67466347 AAGTCTCTGCTCTGTTGCCCAGG - Intergenic
974942640 4:68487913-68487935 GAGTCTCACCCTTGTCACCCAGG - Intronic
975458848 4:74626906-74626928 CAGTCTTGTTTCTGTCACCCAGG + Intergenic
975882851 4:78931330-78931352 CAGTCACAGCTCTGTCACCCAGG - Intronic
976018523 4:80590609-80590631 GAGTCTCAACTCTGTCATCCAGG - Intronic
976175488 4:82347608-82347630 GAGTCTCGGCTCTGTCTCTCAGG - Intergenic
976274829 4:83265547-83265569 GAGTCTTCCCTCTGTCACCCAGG - Intronic
976566472 4:86555418-86555440 GAGTCTCAACTCTGTCACCCAGG - Intronic
977565036 4:98571997-98572019 CAGTCTCAACTCTGTCACCCAGG + Intronic
977929216 4:102733377-102733399 CTTGCTCTGCTCTGTCACCCAGG + Intronic
977943173 4:102879966-102879988 GAGTCTCTTCTCTGTCTCCCAGG + Intronic
978125066 4:105125643-105125665 CAATCTCAGCTCCGCCTCCCGGG + Intergenic
978157179 4:105502304-105502326 CAGAGTCTGCTCTGTCACCCAGG - Intergenic
978701744 4:111655179-111655201 CAGGCTCAACTCTGGCAACCTGG + Intergenic
978785248 4:112601709-112601731 GAGTCTTAACTCTGTCACCCAGG - Intronic
979550551 4:121986267-121986289 CACTGTAAGCTCTGTCTCCCGGG - Intergenic
980056053 4:128081102-128081124 GACTCTCGTCTCTGTCACCCAGG + Intronic
980122408 4:128741478-128741500 GAGTCTCGGCTCTGTCTCCCAGG - Intergenic
980133052 4:128834558-128834580 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
980144856 4:128969494-128969516 CACTGTCAGCTCTGCCTCCCGGG - Intronic
980573807 4:134659544-134659566 CAGGTTTAGTTCTGTCACCCAGG + Intergenic
980682458 4:136180988-136181010 GAGACAGAGCTCTGTCACCCAGG - Intergenic
980724697 4:136743144-136743166 CAGTCTCAAATCTATCTCCCTGG + Intergenic
980914787 4:139024084-139024106 GAGTCTCCACTTTGTCACCCAGG + Intronic
980933118 4:139200206-139200228 CGGTCTCAACTCTGTCACCCAGG - Intergenic
980943664 4:139298697-139298719 AGGTCTCAGCTCTGTTGCCCAGG + Intronic
980981902 4:139661700-139661722 CAGAGCAAGCTCTGTCACCCAGG + Intergenic
981023354 4:140051529-140051551 GAGTCTCATCTCTGTCACTCAGG - Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
981746485 4:148057204-148057226 TAGTGCCAGCTCTGGCACCCAGG + Intronic
981967185 4:150618078-150618100 CTTGCTCTGCTCTGTCACCCAGG - Intronic
982020024 4:151194049-151194071 GTCACTCAGCTCTGTCACCCAGG + Intronic
982027957 4:151270947-151270969 GGGTCTCAACTCTGTCACCCAGG + Intronic
982210656 4:153032352-153032374 ACGTCTCAGTTCTGTTACCCAGG - Intergenic
982246429 4:153356826-153356848 CAGAGTCTACTCTGTCACCCAGG + Intronic
982299526 4:153865045-153865067 CTGTCTCTGCTGTGTCACACAGG + Intergenic
982685234 4:158480842-158480864 CAGTGTCAGCTCCGCCTCCCGGG - Intronic
982840922 4:160185231-160185253 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
983030452 4:162794965-162794987 GAGTCTCAGCTCTGTCGCCCAGG - Intergenic
983070885 4:163266236-163266258 CAGTCTTAGCCCTCTGACCCTGG - Intergenic
983170346 4:164528766-164528788 GAGTCTCACCTCTGTAGCCCAGG - Intergenic
983399396 4:167244308-167244330 GAGGCTCAGCTCTGCCTCCCTGG + Intergenic
983416378 4:167460438-167460460 CATTGTATGCTCTGTCACCCAGG + Intergenic
983471077 4:168156527-168156549 GAGTCTCCACTCTGTCACCCAGG + Intronic
983572217 4:169222437-169222459 GAGTCTCAGCTCTGTCACCCAGG - Intronic
983578660 4:169285931-169285953 CAGGGTCCGCTCTGTCACCCAGG + Intergenic
983746834 4:171211452-171211474 GGGTCTCCACTCTGTCACCCAGG - Intergenic
983800883 4:171929090-171929112 AAGTCTCTGCTCTGTCACCCAGG + Intronic
983822601 4:172214538-172214560 CAGAGTCTCCTCTGTCACCCAGG + Intronic
984195021 4:176648866-176648888 CAGGGTCTGCTCTGTCGCCCAGG - Intergenic
984768083 4:183414710-183414732 GAGACAGAGCTCTGTCACCCAGG - Intergenic
984921836 4:184771486-184771508 CAACCTCAGATCTGGCACCCAGG + Intronic
985430548 4:189875487-189875509 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
985502219 5:255480-255502 GAGTCTCATCTCTGTTGCCCAGG + Intronic
986163144 5:5249622-5249644 CTCTCTCAGCTCTGCCATCCAGG + Intronic
986314620 5:6578258-6578280 CAGTCCCAGCTTTGTGACTCAGG + Intergenic
986419697 5:7566468-7566490 GGTTCTTAGCTCTGTCACCCTGG - Intronic
986477564 5:8151350-8151372 CTGTCACAGCTTTGTCACTCTGG + Intergenic
986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG + Intergenic
986712139 5:10495602-10495624 CACTCTTCACTCTGTCACCCAGG + Intergenic
986929679 5:12802615-12802637 GAGTCTCCACTCTGTCACCCAGG + Intergenic
987238294 5:15965868-15965890 GAGTTTCTGCTCTGTCACCCAGG - Intergenic
987312022 5:16690433-16690455 CAGTCTCATCTCTGCTGCCCAGG + Intronic
987358062 5:17082419-17082441 CAGTTTTTGCTCTGTCGCCCAGG - Intronic
987670327 5:20998735-20998757 CAGCCTCAGCTGTGGCACCTAGG - Intergenic
987819013 5:22937349-22937371 GCATTTCAGCTCTGTCACCCAGG + Intergenic
987839618 5:23206603-23206625 CAGAGTCTTCTCTGTCACCCAGG + Intergenic
988112702 5:26843466-26843488 GTGTCTCCTCTCTGTCACCCAGG - Intergenic
988203220 5:28097018-28097040 CAGTCTTTGCTGTGTCACCCAGG - Intergenic
988259751 5:28870684-28870706 GAGTCTCGGCTCTGTCACTCAGG + Intergenic
988517532 5:31917766-31917788 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
988528071 5:32003735-32003757 GAGTCTCACTCCTGTCACCCAGG + Intronic
988530811 5:32025625-32025647 CAGTCTCACTCTTGTCACCCAGG + Intronic
988596142 5:32593036-32593058 GGGTCTCTGCTCTGTCACCCAGG + Intronic
989037413 5:37189971-37189993 AAATCTCAAGTCTGTCACCCAGG - Intronic
989055032 5:37358543-37358565 AAGGTCCAGCTCTGTCACCCAGG + Intronic
989270305 5:39525644-39525666 CACTCTGACCTCTGTCGCCCAGG + Intergenic
989416103 5:41178499-41178521 CAGAGCTAGCTCTGTCACCCAGG + Intronic
989599089 5:43184970-43184992 GAGTCTCAGCTCTGTCGCCCAGG - Intronic
989727452 5:44603829-44603851 CTGTCTCTGCTGTGTCACACAGG - Intergenic
989956220 5:50363645-50363667 CTGTCTCAGCTATATCACCTGGG - Intergenic
990090913 5:52047210-52047232 GAGGGTCTGCTCTGTCACCCAGG - Intronic
990243502 5:53838822-53838844 CTGCCTCTACTCTGTCACCCAGG - Intergenic
990327482 5:54692547-54692569 ATGTCTCAGCTGAGTCACCCAGG + Intergenic
990559106 5:56965900-56965922 AAGACTCCACTCTGTCACCCAGG - Intronic
990669582 5:58112992-58113014 GAGTCTCGGCCCTGTCGCCCAGG - Intergenic
991066600 5:62431002-62431024 CAGAGTCTCCTCTGTCACCCAGG + Intronic
991358365 5:65793604-65793626 CAAGGTCTGCTCTGTCACCCAGG - Intronic
991373789 5:65944425-65944447 CAGAGTTTGCTCTGTCACCCAGG + Intronic
991383011 5:66051867-66051889 AAGGCCTAGCTCTGTCACCCAGG - Intronic
991441111 5:66650283-66650305 TAGTCTCTGCTCTTTCATCCTGG - Intronic
991714526 5:69438858-69438880 GAGTCTCAATTCTGTCACCCAGG - Intronic
991735351 5:69626967-69626989 GGGTCTCGGCTCTGTCACCCAGG + Intergenic
991779568 5:70119216-70119238 GGGTCTCGGCTCTGTCACCCAGG - Intergenic
991811839 5:70482602-70482624 GGGTCTCGGCTCTGTCACCCAGG + Intergenic
991858860 5:70994689-70994711 GGGTCTCGGCTCTGTCACCCAGG - Intronic
991872020 5:71119573-71119595 GGGTCTCGGCTCTGTCACCCAGG - Intergenic
991987992 5:72309288-72309310 CAGAGTCAGCTCTGTCGCCCAGG + Intronic
992462014 5:76969971-76969993 CAGTCTTGGCTCTGTCACCTAGG + Intronic
992488980 5:77222556-77222578 GAGTCTCCACTCTGTCACCCAGG - Intronic
992568268 5:78024413-78024435 GGGTCTCAGCTCTGTCACCCAGG + Intronic
992693664 5:79263417-79263439 CAGGATGTGCTCTGTCACCCAGG + Intronic
992806447 5:80342537-80342559 GAGTCTCAACCCTGTCACCCAGG - Intergenic
992935508 5:81699879-81699901 CATGGTCTGCTCTGTCACCCAGG + Intronic
993158584 5:84259033-84259055 CACTGCCAGCTCTGTCTCCCAGG + Intronic
993650178 5:90510350-90510372 CAGTCTCACTCTTGTCACCCAGG - Intronic
994591862 5:101783792-101783814 CAGTCTCAGGGCTGACACCATGG - Intergenic
994630960 5:102287564-102287586 GAGTCTCTGCTCTGTCACCCAGG + Intronic
994763926 5:103892235-103892257 GAGTCTCGGCTCTGTCCCCCCGG - Intergenic
995787689 5:115847591-115847613 CAGGGTCTCCTCTGTCACCCAGG - Intronic
995968314 5:117937165-117937187 AAGTCTCAGTCTTGTCACCCAGG - Intergenic
996417076 5:123222182-123222204 CATTCTCACTTCTATCACCCCGG + Intergenic
996606326 5:125327868-125327890 CATTCTCAGATCTGCCACACAGG - Intergenic
996728698 5:126696088-126696110 AAGTCTCGTTTCTGTCACCCAGG - Intergenic
996794810 5:127333484-127333506 CAGGGTCCGCTCTGTCACCCAGG - Intronic
997037461 5:130209960-130209982 CCCTCTTAGCTCTGTCACACAGG + Intergenic
997138766 5:131355449-131355471 GAGTTTCAGCTCTGTTGCCCAGG - Intronic
997192738 5:131953577-131953599 CAGGGTCTGCTCTGTCACCTAGG - Exonic
997236466 5:132274887-132274909 CTGTCTCAGTACTGGCACCCTGG - Intronic
997490123 5:134268407-134268429 CACTTCCTGCTCTGTCACCCAGG - Intergenic
997552621 5:134766693-134766715 AAGTCTCACACCTGTCACCCAGG - Intronic
997616306 5:135248539-135248561 CAAAGTCTGCTCTGTCACCCAGG - Intronic
997799431 5:136844921-136844943 CAGTCTTAGCTCAGTCACTGTGG + Intergenic
997914345 5:137909568-137909590 GGGTCTCCACTCTGTCACCCAGG + Intronic
997960854 5:138320277-138320299 GAGTCTTTGCCCTGTCACCCAGG - Intronic
997972521 5:138415461-138415483 GACTGTCTGCTCTGTCACCCAGG + Intronic
998016683 5:138737559-138737581 TACACTCTGCTCTGTCACCCAGG - Intronic
998289548 5:140900301-140900323 CAGTCTCACTTTTGTCGCCCAGG + Intronic
998437495 5:142124849-142124871 GAGTCTCGCCTCTGTCGCCCAGG + Intronic
998469172 5:142369938-142369960 GAGTCTTCGCTCCGTCACCCAGG - Intergenic
998824175 5:146084155-146084177 GAGTCTTGGCTCTGTCACCCAGG - Intergenic
998839653 5:146239801-146239823 GAGTCTCAACTCTGTTCCCCAGG + Intronic
999169794 5:149583785-149583807 CAGGGTCTCCTCTGTCACCCAGG + Intronic
999265848 5:150266357-150266379 CAGTTCCAGCTCTGCCACCACGG - Intronic
999652400 5:153780248-153780270 CTGTCTCAGCTCTGCCACTTGGG + Intronic
999757796 5:154678139-154678161 GCTTCTTAGCTCTGTCACCCTGG + Intergenic
999961221 5:156757664-156757686 CAGTCTCAGCTCTGTCCTGCAGG - Exonic
999979466 5:156944032-156944054 GAGTCTCACCTCTGTCACCCAGG - Intronic
999991683 5:157055837-157055859 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1000215727 5:159154105-159154127 GAGTCTCAACTCTGTTGCCCAGG + Intergenic
1000671739 5:164071704-164071726 CAGTGTCACCACTCTCACCCGGG - Intergenic
1001342013 5:170855829-170855851 GAGTCTCAGCTGTGTCTCCCAGG + Intergenic
1001505596 5:172277041-172277063 CAGAGTCTGCTTTGTCACCCAGG - Intronic
1001603406 5:172943682-172943704 CAATCCCAGCTCTGTGGCCCTGG - Intronic
1002014835 5:176312508-176312530 GAGTCTTTGGTCTGTCACCCAGG - Intronic
1002206760 5:177568361-177568383 GAGTTTCTGCTCTGTCACCCAGG - Intergenic
1002250022 5:177922689-177922711 CTGCCTCAGCTATGTGACCCTGG - Intergenic
1002256265 5:177960497-177960519 GAGTCCTCGCTCTGTCACCCAGG - Intergenic
1002275400 5:178101252-178101274 GGGTCTCACCTCTGTCACCCAGG - Intergenic
1002305925 5:178282894-178282916 CTCGCTCTGCTCTGTCACCCAGG + Intronic
1002412643 5:179095675-179095697 GAGTCTCACCTCTGTCACCCAGG + Intergenic
1002423200 5:179160955-179160977 CAGTGGCTGCTCTGTCACCTAGG + Intronic
1002550520 5:179987191-179987213 GGGTCCCTGCTCTGTCACCCAGG + Intronic
1002555157 5:180031459-180031481 GAGTCTCAACTCTGTCACCCAGG - Intronic
1002759306 6:189529-189551 GAGTCACAGATCTGTCAGCCTGG - Intergenic
1002815185 6:673223-673245 GAGTCTCACTTTTGTCACCCAGG - Intronic
1003065124 6:2898048-2898070 GAGTCTCTGCTCTGTCACCCAGG - Intronic
1003092556 6:3116256-3116278 CCTTCTCAGCTGTGTTACCCAGG + Intergenic
1003202228 6:3972508-3972530 CAGAGTTCGCTCTGTCACCCAGG + Intergenic
1003287376 6:4746336-4746358 GAGAGTCTGCTCTGTCACCCAGG - Intronic
1003539005 6:7001914-7001936 GGGTCTCAACTCTGTCTCCCAGG + Intergenic
1004149674 6:13104056-13104078 GAGTCTCAACTCTGTTGCCCAGG - Intronic
1004225488 6:13780832-13780854 CGGTCTATTCTCTGTCACCCAGG - Intergenic
1004648954 6:17590020-17590042 AAGTTTTTGCTCTGTCACCCAGG + Intergenic
1004657220 6:17674744-17674766 GAGTCTTGGCTCTGTCGCCCAGG - Intronic
1004826080 6:19422590-19422612 GAGTCTTTGCTCTGTCGCCCAGG - Intergenic
1005017131 6:21385082-21385104 CAGAGTCAGCTCTGCCACCCTGG - Intergenic
1005052258 6:21695596-21695618 CAGAGTCTGCTCTGTCATCCAGG - Intergenic
1005262071 6:24071788-24071810 CAGTTCTCGCTCTGTCACCCAGG - Intergenic
1005335391 6:24791314-24791336 CAGTCTCAGCTCTGTCGCCCAGG + Intergenic
1005353274 6:24957847-24957869 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
1005519731 6:26588845-26588867 GGGTCTCAACTCTGTCACCCAGG - Intergenic
1005526571 6:26657222-26657244 GAGTCTTCGCTCTGTCATCCAGG - Intronic
1005573813 6:27173288-27173310 GGGTCTCATATCTGTCACCCAGG + Intergenic
1005620945 6:27619508-27619530 GGGTCTCAGCTCTGTCACCCAGG - Intergenic
1005652117 6:27894169-27894191 GAGTCTTGGCTCTGTCGCCCAGG + Intergenic
1005829623 6:29660158-29660180 AGGTCTTTGCTCTGTCACCCGGG - Intronic
1005932160 6:30491820-30491842 GAGTCTTGGCTCTGTCACCCAGG + Intronic
1005941703 6:30565321-30565343 GAGTCTCAGCTCTGTCGCCCAGG + Intergenic
1005961892 6:30699635-30699657 GGGTCTCATCTCTGTCACCTAGG - Intergenic
1006074262 6:31519907-31519929 GAGTCTTAACTCTGTCGCCCAGG - Intergenic
1006172310 6:32100698-32100720 GAGTATCAGCTCTGTTGCCCAGG - Intronic
1006345357 6:33476928-33476950 GAGACAGAGCTCTGTCACCCAGG + Intergenic
1006627171 6:35405653-35405675 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1006640600 6:35487695-35487717 CAAGGTCTGCTCTGTCACCCAGG - Intronic
1006713907 6:36101409-36101431 CAGTCTCTGCTCTGTTGCCTAGG - Intronic
1006842327 6:37037041-37037063 CAGTCTCACTATTGTCACCCAGG - Intergenic
1006858162 6:37150737-37150759 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
1007184240 6:39954407-39954429 GGGTCTCAGCTCTGTCACCCAGG + Intergenic
1007343541 6:41209330-41209352 CACTCTCAGCTTTGTCCTCCTGG + Intergenic
1007346763 6:41236862-41236884 CACTCTCAGCTTTGTCCTCCTGG - Intronic
1007388526 6:41536105-41536127 CACTCCCAGCTCTGCCACCTGGG - Intergenic
1007425804 6:41745262-41745284 CAGTTTCACTTTTGTCACCCAGG + Intronic
1007456466 6:41981547-41981569 CAGGGTCTGCTCTTTCACCCAGG + Intronic
1007533353 6:42563083-42563105 GGGTCTCAGCTGTGTCACGCAGG + Intergenic
1007676343 6:43598606-43598628 GAGTCTTTGCTCTGTCGCCCAGG - Intronic
1007731325 6:43949198-43949220 CAGCCTCAGCTCTTTCTCACTGG - Intergenic
1007798331 6:44369522-44369544 GAGTCTTAACTCTGTCGCCCAGG - Intronic
1008012252 6:46480649-46480671 GAGTCTTCGATCTGTCACCCAGG + Intronic
1008073180 6:47118138-47118160 GAGTCTGGGCTCTGTCGCCCAGG - Intergenic
1008245785 6:49171284-49171306 GAGTCTCGTCTCTGTCATCCAGG + Intergenic
1008972778 6:57389128-57389150 GGGTCTCTACTCTGTCACCCAGG + Intronic
1009156230 6:59818776-59818798 GGGTCTCAGCTCTGTGGCCCAGG - Intergenic
1009161685 6:60290683-60290705 GGGTCTCTACTCTGTCACCCAGG + Intergenic
1009197050 6:60699362-60699384 CAGTCCCAGCTCTGTCTCCATGG + Intergenic
1009952999 6:70418353-70418375 CAGAGTCTGCTCTGTTACCCAGG + Intronic
1009954211 6:70433098-70433120 CAGTCTTTGCTCTGTCGCCCAGG + Intronic
1009996427 6:70900428-70900450 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1010087899 6:71942090-71942112 CAGTCTCCACTCTGGCACCATGG - Intronic
1010088532 6:71951514-71951536 GAGTCTCCACTCTGTCACCCAGG + Intronic
1010205544 6:73319702-73319724 GAGTCTCACCCTTGTCACCCAGG + Intergenic
1010415657 6:75608431-75608453 TCTTCTCAGCTCTGTCACCCAGG - Intronic
1011419987 6:87161446-87161468 GGGTCTCCACTCTGTCACCCAGG + Intronic
1011595489 6:89012225-89012247 CAGGATCTGCTCTGTCACCCCGG + Intergenic
1011671148 6:89684315-89684337 CAGTCTCAACTCTGTTGCCTAGG - Intronic
1011684502 6:89813523-89813545 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1012188542 6:96252213-96252235 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
1012579575 6:100850072-100850094 GAGTCTCAATTCTGTCACCCAGG - Intronic
1012899274 6:104988595-104988617 CAGAGTCTACTCTGTCACCCAGG + Intronic
1012968451 6:105701111-105701133 CAGTCTCACTCTTGTCACCCAGG + Intergenic
1013009906 6:106110558-106110580 CAGTTTTTGCTCTGCCACCCAGG + Intergenic
1013051699 6:106542306-106542328 CAGGCCTTGCTCTGTCACCCAGG + Intronic
1013076347 6:106775096-106775118 CGGAGTCTGCTCTGTCACCCAGG + Intergenic
1013217788 6:108046025-108046047 GACTCTCGGCTTTGTCACCCAGG + Intronic
1013349432 6:109291965-109291987 CAGCCTGAGGTATGTCACCCTGG - Intergenic
1014051544 6:116961460-116961482 CAGGGTCCCCTCTGTCACCCAGG + Intergenic
1014095934 6:117461300-117461322 GAGTCTCACATTTGTCACCCGGG - Intronic
1014118051 6:117688390-117688412 CAGTATCTGCCCAGTCACCCAGG - Intronic
1014261313 6:119221496-119221518 GAGTCTCATTTCTGTCACCCAGG + Intronic
1014622905 6:123691522-123691544 GAGTCTCGGCTCTGTCACCCAGG + Intergenic
1014651705 6:124047649-124047671 TAGTATCAGCTCTGGCACCCAGG + Intronic
1014910008 6:127080393-127080415 GAGTCTCCACTCTGTCACCCAGG - Intergenic
1015017327 6:128429325-128429347 CCCTGTCAGCTCTGTCACCAGGG - Intronic
1015171055 6:130254017-130254039 AAGTCTCACTCCTGTCACCCAGG + Intronic
1015273965 6:131365505-131365527 GAGTCTCACTTCTGTCCCCCAGG - Intergenic
1015404185 6:132818894-132818916 CAGTCTTCACTCTGTCACCCAGG + Intergenic
1015652354 6:135477821-135477843 CAGTCTCCGCTCTGTTGCCCAGG + Intronic
1016091166 6:139980884-139980906 GAGTCTCACTTCTGTCAACCAGG - Intergenic
1016454492 6:144216427-144216449 CTGTCTCGGCTCTCTCAGCCCGG - Intergenic
1016503228 6:144746508-144746530 GAGTCTCAACTCTGGCACCCAGG + Intronic
1016796450 6:148123078-148123100 CAGGGTCTCCTCTGTCACCCAGG + Intergenic
1016836951 6:148486894-148486916 GGGTCTCTACTCTGTCACCCAGG - Intronic
1016867488 6:148782101-148782123 GAAACTCAGCTCTGTCACCCAGG + Intronic
1016944228 6:149513357-149513379 GAGTCCCCGCTCTGTCACCCAGG - Intronic
1017045960 6:150347522-150347544 AGATCTCAGCTCCGTCACCCAGG + Intergenic
1017093569 6:150783393-150783415 GAGTCTCACTTTTGTCACCCAGG + Intronic
1017150084 6:151271683-151271705 GAGTCTCAGCTCTGTCGCCCAGG + Intronic
1017694179 6:156998244-156998266 GAGTTTCCACTCTGTCACCCAGG + Intronic
1017788504 6:157775330-157775352 CAGAGTCTCCTCTGTCACCCAGG - Intronic
1017878136 6:158540791-158540813 GAGTCTCACCCCTGTCACCAAGG + Intronic
1017974995 6:159349142-159349164 CAGTCTCAGCCTTGTCATACAGG + Intergenic
1018080873 6:160258575-160258597 CAGACTCAGCTCGGCCACTCCGG + Exonic
1018365319 6:163114222-163114244 GAGTCTCAGTTCTCTCACCCAGG - Intronic
1018776975 6:167026335-167026357 GAGTCTCATCACTGTCACTCAGG - Intronic
1018900598 6:168050012-168050034 CTGTCGCAGCTCTCACACCCTGG - Intergenic
1019667253 7:2258034-2258056 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1019811218 7:3166474-3166496 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1019818049 7:3215851-3215873 AAATCCCAGCTCTGTCACCTTGG - Intergenic
1019968397 7:4520176-4520198 CATTCTTAGCTCTGTTGCCCAGG - Intergenic
1020167051 7:5815737-5815759 GAGTCTTAACTCTGTCACCCAGG + Intergenic
1020175492 7:5878719-5878741 GAGTCTCAATTCTGTCGCCCAGG - Intergenic
1020248004 7:6445534-6445556 GAGTCTCCACTCTGTCACTCAGG + Intronic
1020708623 7:11577340-11577362 CAGAGTCTGCTCTGTCACCCAGG + Intronic
1020720309 7:11736433-11736455 CAGAGTCTGCTGTGTCACCCAGG - Intronic
1021298400 7:18938567-18938589 GAGTCTCGCCTCTGTCGCCCAGG - Intronic
1021449448 7:20769386-20769408 CGGAGTCTGCTCTGTCACCCAGG + Intronic
1021646706 7:22796147-22796169 GAGTCTTTGCTCTGTCGCCCAGG + Intergenic
1021686488 7:23191929-23191951 CAGTCTCATTCCTGTCACCCAGG - Intronic
1021987410 7:26110343-26110365 CAGAGTCAGCTCTGTCTCCCAGG + Intergenic
1021990510 7:26137191-26137213 CAAGATCGGCTCTGTCACCCAGG + Intergenic
1022402477 7:30052612-30052634 GGGTCTCCACTCTGTCACCCAGG - Intronic
1023147851 7:37169925-37169947 CAGTCTCACTCTTGTCACCCAGG + Intronic
1023159841 7:37286362-37286384 CAGTAACAGCTTTGTCACCTGGG + Intronic
1023384663 7:39643831-39643853 AAGTCTCAACTTTGTCACCCAGG - Intronic
1023425556 7:40032079-40032101 CAGGTCCTGCTCTGTCACCCAGG + Intronic
1023602615 7:41894800-41894822 CAAAGTCAGCTCTGTCACCCAGG - Intergenic
1023605308 7:41925921-41925943 CAGTCTAAGCTGTGTGACCTTGG + Intergenic
1023751451 7:43376838-43376860 GAGTCCTTGCTCTGTCACCCAGG - Intronic
1023794612 7:43781370-43781392 CAGTCTCACCCTTGTCACCCAGG + Intronic
1023964083 7:44952789-44952811 GAGTTTCCCCTCTGTCACCCAGG - Intergenic
1024313664 7:47993051-47993073 GGGTCTCAGCTCTGTTGCCCAGG - Intronic
1024482222 7:49875620-49875642 CAGTATCAGCTCTGTGGCCTTGG + Intronic
1024570983 7:50722621-50722643 CACTCTGGGCCCTGTCACCCTGG - Intronic
1024626978 7:51216204-51216226 GAGTCTCAACTCTGTTGCCCAGG + Intronic
1024798304 7:53045636-53045658 CTTGCTCTGCTCTGTCACCCAGG - Intergenic
1024963502 7:55002890-55002912 GGGTCTTAGCTCTGTCACCCAGG + Intergenic
1025841302 7:65152104-65152126 GGGTCTCACTTCTGTCACCCAGG - Intergenic
1025881744 7:65543841-65543863 GGGTCTCACTTCTGTCACCCAGG + Intergenic
1025891697 7:65658791-65658813 GGGTCTCACTTCTGTCACCCAGG - Intergenic
1026017254 7:66681427-66681449 CTCGCTCTGCTCTGTCACCCGGG + Intronic
1026078269 7:67193410-67193432 AAGTCCCAGCTCTGTCATCAGGG + Intronic
1026158140 7:67845594-67845616 GAGTCTCACTTTTGTCACCCAGG - Intergenic
1026442859 7:70459063-70459085 CAGTCTTAGTTCTCTCTCCCGGG - Intronic
1026446503 7:70488879-70488901 CAGTCCCACCTCTGTCCCACGGG + Intronic
1026520720 7:71115714-71115736 CAGAGTCTGCTCTGTCATCCAGG - Intergenic
1026584425 7:71644723-71644745 GGGTCTCTGCTCTGTCACCCAGG - Intronic
1026659483 7:72287470-72287492 GAGTCTCGGCTCTGTCACCCAGG + Intronic
1026660902 7:72301580-72301602 AAGTCTTTGCTCTGTCGCCCAGG - Intronic
1026667989 7:72360752-72360774 GAGTCTCCCCTCTGTCACCCAGG + Intronic
1026698551 7:72618561-72618583 AAGTCCCAGCTCTGTCATCAGGG - Intronic
1026887563 7:73962217-73962239 CAGAGTTTGCTCTGTCACCCAGG + Intergenic
1027154693 7:75758343-75758365 CAGAGTCTTCTCTGTCACCCAGG + Intergenic
1027186769 7:75976874-75976896 CAGTCTCACTCCTGTCACCCAGG + Intronic
1027243501 7:76349311-76349333 CAGAGTCTGCTCTGTCGCCCAGG - Intronic
1027310071 7:76946411-76946433 GGGTCTTGGCTCTGTCACCCAGG - Intergenic
1027389635 7:77692106-77692128 AGGTCTCAGCTCTATCACCCAGG - Intergenic
1027582265 7:80012864-80012886 CACTGTCACCTCTGTCTCCCAGG - Intergenic
1028136429 7:87227734-87227756 AAGTTGCTGCTCTGTCACCCAGG - Intergenic
1028170467 7:87589757-87589779 AGGTCTTAACTCTGTCACCCAGG - Intronic
1028361630 7:89974468-89974490 GAGTCTCTTCTCTGTCGCCCAGG + Intergenic
1029000576 7:97150637-97150659 CACTGTAAGCTCTGCCACCCGGG + Intronic
1029148296 7:98462425-98462447 CAGGAACAGCTCTGTCATCCTGG - Intergenic
1029280300 7:99431047-99431069 GAGTTTTGGCTCTGTCACCCTGG - Intronic
1029375784 7:100176301-100176323 CAGCCTCTGCTCTGTCTCACTGG + Exonic
1029634429 7:101774483-101774505 GGGTCTCAGCTCTGTCACCCAGG - Intergenic
1029664207 7:101984006-101984028 CAGTCTCAGCTCTGTCACCCAGG - Intronic
1029712583 7:102307721-102307743 CCCTCCCAGCTCTGTCATCCTGG + Intronic
1030000838 7:105060019-105060041 GAGTCTTAACTCTGTCGCCCAGG + Intronic
1030021654 7:105280919-105280941 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
1030041924 7:105459461-105459483 GAGTCTCAACTCTGTCACCTAGG + Intronic
1030062451 7:105633692-105633714 GAGTCTCCCCCCTGTCACCCAGG - Intronic
1030238615 7:107294044-107294066 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1030706882 7:112701929-112701951 CAGGGTCTGTTCTGTCACCCAGG - Intergenic
1030720219 7:112862227-112862249 CAGTCTCATTCCTGTCGCCCAGG - Intronic
1031618664 7:123909804-123909826 CAGAATCTCCTCTGTCACCCAGG + Intergenic
1032014284 7:128367226-128367248 CAGAGTCTGCTCTGTCACCTAGG + Intergenic
1032023513 7:128423301-128423323 CAGTTTCACCCTTGTCACCCAGG + Intergenic
1032028910 7:128465316-128465338 AGGTCTCAACTTTGTCACCCAGG + Intergenic
1032042224 7:128572842-128572864 AGGTCTTGGCTCTGTCACCCAGG + Intergenic
1032045808 7:128606649-128606671 GAGTCTTGGCTCTGTCACCCAGG + Intergenic
1032136565 7:129284571-129284593 AAGTCTCAACTCTGTCATCTAGG - Intronic
1032212864 7:129931898-129931920 CAATCTCAGCTCCGCCTCCCAGG + Intronic
1032214228 7:129944327-129944349 GAGTCTTCGCTCTGTCGCCCAGG - Intronic
1032243904 7:130190490-130190512 GAGTCTTGGCTCTGTCGCCCAGG - Intronic
1032312824 7:130803970-130803992 GAGTGTCACCTCTGTCGCCCAGG - Intergenic
1032442460 7:131952485-131952507 GAGTCTCGGCTCTGTCGCCCAGG - Intergenic
1032918472 7:136518467-136518489 CAGTTTCTCCTCTGTCACCAAGG + Intergenic
1033084334 7:138328430-138328452 CAGTCACAGTCCTGGCACCCAGG - Intergenic
1033174361 7:139110788-139110810 AAGTCTCAGCGCTATCCCCCAGG - Intergenic
1033247395 7:139729297-139729319 CAGGGTCTACTCTGTCACCCAGG - Intronic
1033500771 7:141946798-141946820 CAGACTCACCTCTTTCTCCCTGG + Exonic
1033644470 7:143290084-143290106 GAGTCTTTGCTGTGTCACCCAGG + Intronic
1033729847 7:144166953-144166975 CAGTGTCAGCTCTGTTGTCCAGG - Intergenic
1033900008 7:146125548-146125570 CTCGCTCTGCTCTGTCACCCAGG - Intronic
1034117244 7:148594199-148594221 GAGTCTTCGCTCTGTCGCCCAGG + Intronic
1034157589 7:148968304-148968326 GAGTCTCAATTCTGTCACCCTGG + Intergenic
1034357932 7:150468048-150468070 CAGTGTCAGCTCTGCTACCCTGG + Intronic
1034359997 7:150486847-150486869 CAGAGTCCCCTCTGTCACCCAGG + Intergenic
1034409276 7:150930847-150930869 GAGTCTCAGCTCTGTTCCCCAGG - Intergenic
1034578539 7:152023163-152023185 CTGTCTCAACACTGTTACCCTGG - Intergenic
1034599157 7:152231953-152231975 CAGTGCAAGCTCTGTCTCCCAGG + Intronic
1034603146 7:152282269-152282291 AAGGTCCAGCTCTGTCACCCAGG - Intronic
1034613991 7:152398851-152398873 GGGTTTCAGCTCTGTCACCCAGG + Intronic
1034644746 7:152635411-152635433 AGGTCTTGGCTCTGTCACCCAGG + Intergenic
1034703965 7:153123758-153123780 GAGTCTCATTTTTGTCACCCAGG + Intergenic
1034913774 7:155020043-155020065 GAGTCTTAACTCTGTCGCCCAGG - Intergenic
1035068915 7:156126859-156126881 GAGTCTTAGCCCTGTCGCCCAGG + Intergenic
1035134241 7:156684929-156684951 CAGGGTCTCCTCTGTCACCCAGG - Intronic
1035207184 7:157301309-157301331 CAGTTTCACTCCTGTCACCCAGG - Intergenic
1035374108 7:158395948-158395970 CACTCTCACCTCTGTGACCAGGG - Intronic
1035408099 7:158614047-158614069 CAGGCCTCGCTCTGTCACCCAGG + Intergenic
1035445372 7:158937872-158937894 CAGTATTCACTCTGTCACCCAGG - Intronic
1035601443 8:899305-899327 ACGTCTCAGCTCTGCCACCACGG - Intergenic
1036427508 8:8659122-8659144 TGACCTCAGCTCTGTCACCCAGG + Intergenic
1036594316 8:10198647-10198669 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1036641479 8:10586847-10586869 GAGTGACAGCTCTGCCACCCAGG + Intergenic
1036734169 8:11294525-11294547 GAGTCTCAACTCTGTCACCTAGG + Intronic
1036916331 8:12807328-12807350 GAGTCTCACTCCTGTCACCCAGG - Intergenic
1036949042 8:13123364-13123386 GAGTCTCAACTCTGTCTCCCAGG + Intronic
1036953592 8:13163975-13163997 CAGTGTCTCCTCTGTCATCCAGG - Intronic
1037180496 8:15999569-15999591 GAGTCTCACTTTTGTCACCCAGG + Intergenic
1037297910 8:17420712-17420734 CAGGGTCACCTCTGTCACCCAGG - Intergenic
1037919945 8:22798761-22798783 GAGTCTTAACTCTGTCACCCAGG + Intronic
1037954111 8:23040153-23040175 CAGGGTCTGCTCTGTCACCCAGG - Intronic
1038000671 8:23388561-23388583 AAGTCCCAGCTCTGTCGCCCAGG - Intronic
1038227270 8:25669077-25669099 CAGTAACAGCTCTGTGACCTTGG + Intergenic
1038323322 8:26549161-26549183 CAGTCTTCCCTCTGTCACCTGGG - Intronic
1038432429 8:27510921-27510943 GGGTCTCTGCTCTGTCATCCAGG - Intronic
1038586730 8:28796282-28796304 CAGAGTCTTCTCTGTCACCCAGG - Intronic
1038736248 8:30172474-30172496 GAGTCTCGGCTCTGTCACCCAGG + Intronic
1038942914 8:32325405-32325427 CAGAGACAGCTCTGTCCCCCAGG + Intronic
1039022776 8:33225695-33225717 GTTTCCCAGCTCTGTCACCCAGG - Intergenic
1039523297 8:38190781-38190803 GAGTCTCTGCTCTGTGGCCCAGG + Intronic
1039564698 8:38542602-38542624 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1039984816 8:42438337-42438359 GGGTCTCAGCTCTGTCACCCAGG + Intronic
1040455682 8:47594968-47594990 TGGTCTCGGCTCTGTCGCCCAGG - Intronic
1040957460 8:52994458-52994480 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1040967036 8:53093094-53093116 CTGTCTCTGCTGTGTCACACAGG + Intergenic
1041062975 8:54054004-54054026 GAGTCTCAGCTCTGTTGCCCAGG + Intronic
1041153739 8:54962567-54962589 CCATCTCACCTCTGCCACCCAGG + Intergenic
1041307849 8:56482007-56482029 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1041539884 8:58971712-58971734 GAGTCTCTCCTCTGTCACCTAGG + Intronic
1041774358 8:61508038-61508060 CAGGATTTGCTCTGTCACCCAGG + Intronic
1041953312 8:63529201-63529223 GGGTCTCACTTCTGTCACCCTGG + Intergenic
1042262444 8:66872929-66872951 GAGTCCCAACTCTGTCGCCCAGG - Intronic
1042521939 8:69722143-69722165 GAGTCTTTGCTCTGTCACCCAGG - Intronic
1042524643 8:69751571-69751593 CAGTCTTGCCTCTGTCACTCAGG + Intronic
1042807879 8:72791521-72791543 GAGTCTCACCTGTGTCACCCAGG - Intronic
1042893330 8:73636835-73636857 CAGAGTCTCCTCTGTCACCCAGG - Intronic
1043060497 8:75495561-75495583 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1043429470 8:80180740-80180762 GAGTCTAGGCTCTGTCGCCCAGG - Intronic
1043437028 8:80244908-80244930 CAGGGTCTCCTCTGTCACCCAGG - Intergenic
1043456262 8:80415451-80415473 CATTCTGTCCTCTGTCACCCAGG + Intergenic
1044058241 8:87599586-87599608 GGGTCTCGCCTCTGTCACCCAGG + Intronic
1044660230 8:94587972-94587994 CAGGGTCTTCTCTGTCACCCAGG - Intergenic
1045099191 8:98827306-98827328 CAAGGTCTGCTCTGTCACCCAGG - Intronic
1045226022 8:100246424-100246446 GGGTCTCAGCTCTGTTGCCCAGG + Intronic
1045459660 8:102414557-102414579 GAGTCTTTGCTCTGTCGCCCAGG + Intergenic
1045510944 8:102811516-102811538 AAGGCCCTGCTCTGTCACCCAGG - Intergenic
1045553215 8:103191171-103191193 CAGTCTCACTCTTGTCACCCAGG - Intronic
1045625868 8:104049397-104049419 GAGTCTCCGCTCTGTCGCCCAGG - Intronic
1045629894 8:104106011-104106033 CAGAGTCTTCTCTGTCACCCAGG - Intronic
1045665497 8:104480174-104480196 AAGGCTTTGCTCTGTCACCCAGG + Intergenic
1046847152 8:118930435-118930457 GAGTCTCATCTCTGTCACCCAGG + Intronic
1046930145 8:119833571-119833593 CAGTCTCAGCTCTGTCGCCCAGG - Intergenic
1047034648 8:120923954-120923976 CAGTCTCAACTCTGTTGCCCAGG + Intergenic
1047039695 8:120979180-120979202 GTGTCTGATCTCTGTCACCCAGG - Intergenic
1047353069 8:124094509-124094531 GAGTCCCTGCTCTGTCACCCAGG + Intronic
1047602497 8:126440235-126440257 GAGTCTTAACTCTGTCGCCCAGG + Intergenic
1047683931 8:127284457-127284479 CAGGGTCTGCTCTGTCACCCAGG + Intergenic
1048159019 8:131994215-131994237 GTGTCTCTTCTCTGTCACCCTGG - Intronic
1048571471 8:135660513-135660535 GGGTCTTTGCTCTGTCACCCAGG + Intergenic
1048971882 8:139649722-139649744 AATTCTCAGCTGTGTAACCCTGG + Intronic
1049062225 8:140285580-140285602 CTGTCTCATCTCTGCCACCCTGG + Intronic
1049083805 8:140462368-140462390 CACTCTTTGCTCTGTCTCCCAGG - Intergenic
1049113297 8:140663697-140663719 CAGGGTTTGCTCTGTCACCCAGG + Intronic
1049113890 8:140669089-140669111 AAGCCTCAGCTCTCTCACCCGGG + Intronic
1049214656 8:141402149-141402171 CAGCCTCAGACCCGTCACCCAGG - Intronic
1049643586 8:143726424-143726446 CAGCCTCCGTGCTGTCACCCTGG + Exonic
1049754377 8:144302794-144302816 CAGAGTCTGCTTTGTCACCCAGG - Intronic
1049869966 8:144966792-144966814 CTCCCTTAGCTCTGTCACCCAGG - Intergenic
1050103841 9:2145275-2145297 GAGTCTTCACTCTGTCACCCAGG - Intronic
1050349811 9:4729803-4729825 CAGTCTCTTCTCTGTCACCAAGG - Intronic
1050540034 9:6661769-6661791 GAGTCTCTTCTCTGTCACCCAGG - Intergenic
1050544400 9:6697468-6697490 GAGTCTTGTCTCTGTCACCCAGG - Intergenic
1051436482 9:17038582-17038604 GAGTTTTCGCTCTGTCACCCAGG + Intergenic
1051465687 9:17374832-17374854 GAGTCTCACTTCTGTCACCCAGG - Intronic
1051802913 9:20957087-20957109 AGGTCTCGGCTCTATCACCCAGG + Intronic
1052006671 9:23357695-23357717 CTGTCTCTGCTGTGTCACACTGG + Intergenic
1052299209 9:26934503-26934525 CAGTCTCCACTCTGTCACCCAGG + Intronic
1052919180 9:33949675-33949697 GAGTCTAAGCTCTGTCACCCAGG - Intronic
1053222423 9:36323373-36323395 GGGTCTTCGCTCTGTCACCCAGG - Intergenic
1053263831 9:36695747-36695769 CAGGATCTCCTCTGTCACCCAGG - Intergenic
1053396064 9:37775553-37775575 CAGGGTCTCCTCTGTCACCCAGG + Intronic
1053494412 9:38539773-38539795 AAGTCTCACTTTTGTCACCCAGG - Intergenic
1053525398 9:38824921-38824943 GAGTCTTTGCTCTGTCAACCAGG - Intergenic
1054197627 9:62049349-62049371 GAGTCTTTGCTCTGTCAACCAGG - Intergenic
1054640782 9:67539353-67539375 GAGTCTTTGCTCTGTCAACCAGG + Intergenic
1054897545 9:70330574-70330596 GAGTCTTCACTCTGTCACCCAGG + Intronic
1054978354 9:71174513-71174535 GAGTCTCAACTCTGTTGCCCAGG - Intronic
1055003909 9:71484170-71484192 GAGTCTCACTTCTGTCACCCAGG + Intergenic
1055056192 9:72026603-72026625 CACTCTAAGCTCTGCCTCCCCGG + Intergenic
1055365077 9:75534887-75534909 CAGTCTCACTCCTGTCACCCAGG - Intergenic
1055607817 9:77989408-77989430 CAGGCTCAGCTCAGTCACTAGGG - Intronic
1055812851 9:80170511-80170533 GAGTCTTTGCTCTGTCACCCAGG + Intergenic
1055929073 9:81541056-81541078 GAGTCTCATCTCTGTCACCCAGG - Intergenic
1055939069 9:81632062-81632084 GAGTCTTCGCTCTGTCACCCAGG - Intronic
1055947444 9:81704129-81704151 AGGTCTTGGCTCTGTCACCCCGG - Intergenic
1056068045 9:82957266-82957288 GAGTCTCGCTTCTGTCACCCAGG - Intergenic
1056157050 9:83848837-83848859 GGGTCTTAACTCTGTCACCCAGG + Intronic
1056228593 9:84521752-84521774 GAATCCCAGCTCTGTCACCATGG - Intergenic
1056353491 9:85775275-85775297 GGGTCTTAACTCTGTCACCCAGG - Intergenic
1056394227 9:86166988-86167010 AAGGCTTTGCTCTGTCACCCAGG + Intergenic
1056596822 9:88014606-88014628 CAGGGTCTTCTCTGTCACCCAGG - Intergenic
1056803948 9:89713469-89713491 CAGTCTCACCTGTGACCCCCAGG - Intergenic
1056940431 9:90951320-90951342 GAGTCTCAACTCTGTCGCCCAGG + Intergenic
1056967441 9:91177048-91177070 GAGTCTCCCCTCTGTCGCCCAGG - Intergenic
1056989530 9:91397840-91397862 CAGTTCTCGCTCTGTCACCCAGG + Intergenic
1057105979 9:92417742-92417764 CAGTGTCTCCTCTGTCACCCAGG + Intronic
1057180685 9:93028421-93028443 CAGTTCCAGCTCTGACATCCTGG + Intronic
1057474504 9:95387229-95387251 GAGTCTCCACTCTGTCACCCAGG + Intergenic
1057501517 9:95600579-95600601 GAGTCCCCGCTCTGTCGCCCAGG + Intergenic
1057780394 9:98045085-98045107 CAGAGTCTGCTCTGTCACCTAGG - Intergenic
1057781056 9:98050797-98050819 CAGAGTCTACTCTGTCACCCAGG + Intergenic
1058180868 9:101797157-101797179 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1058444305 9:105040820-105040842 CACTCTCACCTCTGTCAGACAGG + Intergenic
1058511618 9:105724595-105724617 GAGTCTCACCTCTGTCACCCAGG - Intronic
1059106969 9:111520480-111520502 GAGTCTCGGCTCTGTCACCCAGG + Intergenic
1059169148 9:112108750-112108772 GACACCCAGCTCTGTCACCCAGG - Intronic
1059324328 9:113494899-113494921 GAGTCTTGGCTCTGTCACCCAGG + Intronic
1059881921 9:118700594-118700616 GGGTCTCAGCTCTGTCACCCAGG + Intergenic
1060002415 9:119970437-119970459 GAGTCTCCACTCTGTCGCCCAGG + Intergenic
1060021134 9:120132230-120132252 CAGTCCCAGCTCTGTCTCAGTGG + Intergenic
1060036182 9:120257677-120257699 GAGTCACAGCTCAGCCACCCGGG - Intergenic
1060169653 9:121451221-121451243 CAGAGTCTGCTCTGTCACCCAGG + Intergenic
1060277800 9:122194992-122195014 GAGTTTTTGCTCTGTCACCCAGG - Intronic
1060277901 9:122195997-122196019 GGTTCTCAACTCTGTCACCCAGG + Intronic
1060366170 9:123016479-123016501 GGGTCTCAACTCTGTCACCCAGG - Intronic
1060413574 9:123415500-123415522 CAGCCTCAGCTCTGGTCCCCAGG - Intronic
1060539045 9:124416891-124416913 GAGTCTCTGCTCTGTTGCCCAGG - Intergenic
1060613437 9:124989553-124989575 CAGTCTCACTCTTGTCACCCAGG - Intronic
1060659529 9:125396262-125396284 CAGGGTCTGCTCTGTCTCCCAGG + Intergenic
1060869160 9:127025715-127025737 CAGTCTTTGTTCTGTCATCCAGG + Intronic
1060926066 9:127456257-127456279 GACGCTCTGCTCTGTCACCCAGG + Intronic
1060936345 9:127518284-127518306 CACTCCCTGCTCTGTGACCCTGG - Intronic
1061088702 9:128414200-128414222 CAGTGTCTGCTCTGTTGCCCCGG + Intronic
1061104437 9:128518533-128518555 GATTCTCAACTCTGTCACCCAGG - Intronic
1061131340 9:128709949-128709971 GACTCTGAGCTCTGTCACCCAGG + Intronic
1061307017 9:129738024-129738046 CATTATCAGCTCCGTCAACCAGG - Intergenic
1061480006 9:130893125-130893147 CAGCCTCAGCTCCGTGCCCCTGG + Intergenic
1061548887 9:131320907-131320929 GAGTCTCGGCTCTGTTGCCCAGG - Intergenic
1061551696 9:131338609-131338631 GAGACAGAGCTCTGTCACCCAGG - Intergenic
1061554605 9:131359397-131359419 GAGTCTCGGCTCTGTCGCCCAGG - Intergenic
1061835423 9:133325667-133325689 CAGGCCTCGCTCTGTCACCCAGG - Intergenic
1061920771 9:133781207-133781229 CATCCTCAGCTCAGACACCCAGG + Intronic
1062336076 9:136068980-136069002 CAATCTCGGCTCTGTCTCCCAGG + Intronic
1062550660 9:137084795-137084817 CATGCTCAGCTCTGACAGCCTGG + Intergenic
1062719331 9:138028096-138028118 CGGTCTCGGCTCTGCCTCCCAGG + Intronic
1203743653 Un_GL000218v1:24763-24785 GAGTCTCAACTTTGTCACCCAGG + Intergenic
1203566461 Un_KI270744v1:94772-94794 GAGTCTCAACTTTGTCACCCAGG - Intergenic
1185483260 X:463853-463875 TAGTCTCACTTTTGTCACCCAGG - Intergenic
1185512599 X:674629-674651 CGATCTCACCTCTGTTACCCAGG + Intergenic
1185514390 X:688199-688221 AAGTCTCATTCCTGTCACCCAGG - Intergenic
1185529829 X:808852-808874 GAGTCTCGCTTCTGTCACCCAGG + Intergenic
1185552967 X:998641-998663 AGGTCACAGCTCTGTCACCCAGG - Intergenic
1185867670 X:3637790-3637812 GAGTCTCACCTCTGTTGCCCAGG + Intronic
1185923248 X:4118115-4118137 CAGTCTCAGCTGTGTTGCCCAGG + Intergenic
1186157546 X:6741131-6741153 GAGTCTTAACTCTGTCGCCCAGG - Intergenic
1186443705 X:9607837-9607859 AAGTCTTCACTCTGTCACCCAGG + Intronic
1186447130 X:9640654-9640676 GAGTCTTTGCTCTGTCACCCAGG + Intronic
1186455163 X:9704851-9704873 CAGGGCCTGCTCTGTCACCCAGG - Intronic
1186487110 X:9941943-9941965 GAGTCTCTGCTCTGCCACCCAGG - Intronic
1186752694 X:12638286-12638308 AGGTCTCCACTCTGTCACCCAGG + Intronic
1187158232 X:16741222-16741244 GGGTCTCAACTCTGTCACCCAGG + Intronic
1187159737 X:16753216-16753238 GAGTCTCACTTTTGTCACCCAGG - Intronic
1187348420 X:18489142-18489164 AAGTCTCCGCTCTGTCACCCAGG + Intronic
1187455362 X:19436701-19436723 GAGTCTCAACTCTGTCATCCAGG + Intronic
1187539197 X:20174778-20174800 GAGTTTCAACTCTGTCACCCAGG + Intronic
1187550327 X:20296320-20296342 GAGTCTCAACTCTGTCACCCAGG - Intergenic
1187697120 X:21933774-21933796 CAGAGTCTCCTCTGTCACCCAGG - Intergenic
1187700017 X:21956307-21956329 CTGTCTCTGTTCTGTCACCCAGG + Intronic
1187850506 X:23587074-23587096 GAGTCTCTGCTCTGTCGCCCAGG - Intergenic
1188010098 X:25045840-25045862 GAGTCTCACTTCTGTCACCCAGG - Intergenic
1188089947 X:25952561-25952583 CAGTCAAAGCTCTGTTTCCCTGG + Intergenic
1188386816 X:29571194-29571216 GAGTCTTCACTCTGTCACCCAGG - Intronic
1188465089 X:30470859-30470881 CAGTCTCACTCTTGTCACCCAGG + Intergenic
1188546067 X:31308753-31308775 GAGTCTCAACTCTGTCGCCCTGG + Intronic
1188789375 X:34389010-34389032 GAGTCTTTGCTCTGTCGCCCAGG - Intergenic
1188908814 X:35820742-35820764 CAGTCTCAAATCTGTCCCCCTGG + Intergenic
1189180332 X:38997950-38997972 GGGGTTCAGCTCTGTCACCCAGG - Intergenic
1189343226 X:40220470-40220492 CAGAGTCTGCTCTGTCACCCAGG + Intergenic
1189374155 X:40453548-40453570 CACTCTGCACTCTGTCACCCAGG + Intergenic
1189457516 X:41206801-41206823 GAGTCTTTGCTCTGTCGCCCAGG + Intronic
1189811452 X:44784663-44784685 GAGTCTTTACTCTGTCACCCAGG + Intergenic
1189815094 X:44816859-44816881 CAGTTTCTGCCCTGTCGCCCAGG - Intergenic
1189840268 X:45068589-45068611 AAGGTTCTGCTCTGTCACCCAGG + Intronic
1190043647 X:47093921-47093943 CAGGATCTACTCTGTCACCCAGG + Intergenic
1190045967 X:47111661-47111683 CAGGGTCAGCTCTGTCACTCAGG - Intergenic
1190233289 X:48598402-48598424 CAGTCTGATTTCTGTCGCCCTGG + Intronic
1190334899 X:49256420-49256442 AAATCCCAGCTCTGTCACTCAGG + Intronic
1190396515 X:49990461-49990483 TCGTCTTGGCTCTGTCACCCAGG + Intronic
1190772872 X:53529538-53529560 GAGTCTCAACTCTGTTGCCCAGG - Intergenic
1190824141 X:54001479-54001501 CAGTCTCACTCTTGTCACCCAGG - Intronic
1190856863 X:54304513-54304535 CAGTGTTTGCTCTGTCACCCAGG - Intronic
1191703570 X:64069415-64069437 CAACCCCAGCTCTGTCATCCAGG + Intergenic
1192327105 X:70142303-70142325 GGGTCTCTACTCTGTCACCCAGG - Intronic
1192345085 X:70296108-70296130 CAGGGTCTGCTCTGTCACCTAGG + Intronic
1192385282 X:70661728-70661750 CAGCCTCCGCTCTGATACCCAGG + Intronic
1192389963 X:70716072-70716094 CAGCCTCCGCTCTGATACCCAGG - Intronic
1192391114 X:70729022-70729044 CAGCCTCCGCTCTGATACCCAGG + Intronic
1192476144 X:71444773-71444795 GAGTCTCCGCTCTGTCGCCCAGG + Intronic
1192491721 X:71581352-71581374 CAGGGTCTGCTCTGTCGCCCGGG + Intronic
1192610747 X:72564132-72564154 GAATCTCGGCTCTGTCATCCAGG - Intronic
1193177810 X:78415256-78415278 GAGTCTCACTTCTGTCACCCAGG + Intergenic
1193870739 X:86795257-86795279 GAATCTTCGCTCTGTCACCCAGG + Intronic
1194047799 X:89031071-89031093 AGGTCTCAACTGTGTCACCCAGG + Intergenic
1194518606 X:94890895-94890917 TAGGATCAACTCTGTCACCCAGG + Intergenic
1194674045 X:96772009-96772031 GGGTCTCAACTGTGTCACCCAGG - Intronic
1195129725 X:101840434-101840456 CAGACACAGCTCAGTCACCCAGG + Intronic
1195163915 X:102198589-102198611 CAGGTTCAGCTCTCTCATCCAGG - Intergenic
1195176513 X:102319389-102319411 CAGACACAGCTCAGTCACCCAGG - Intronic
1195182351 X:102367704-102367726 CAGACACAGCTCAGTCACCCAGG + Intronic
1195194946 X:102488506-102488528 CAGGTTCAGCTCTCTCATCCAGG + Intergenic
1195202380 X:102564089-102564111 CAGACACAGCTCAGTCACCCAGG - Intergenic
1195470598 X:105225710-105225732 CAGAGTCTCCTCTGTCACCCAGG + Intronic
1195615536 X:106909277-106909299 CACTTTTAGCTCTGTGACCCTGG - Intronic
1195705819 X:107737360-107737382 CTGTCCCAGCTTTGTCACACAGG + Intronic
1195838133 X:109143049-109143071 CTGTCTCTGCTCTGTCAAACAGG - Intergenic
1196176617 X:112645577-112645599 CATTCTTAGCTCTGTGACCTTGG - Intronic
1196807688 X:119603274-119603296 CAGAGTCTGCTCTGTCACCCAGG - Intronic
1196839857 X:119849465-119849487 GAGTCTTAACTCTGTCGCCCAGG - Intronic
1197224614 X:123944497-123944519 GAGTCTCAACTCTGTTGCCCAGG - Intergenic
1197238652 X:124097151-124097173 GGGTCTCGGCTCTGTCACCCAGG - Intronic
1197755674 X:129992422-129992444 GGGTCTCAACTCTGTCACCTGGG - Intronic
1197874966 X:131092728-131092750 GAGTCTCATTTGTGTCACCCAGG + Intergenic
1197936168 X:131742185-131742207 GAGTCTCCGCTCTGTCGCCCAGG + Intergenic
1198148764 X:133887030-133887052 GGGTCTCAGCTCTGTTGCCCAGG + Intronic
1198149226 X:133891771-133891793 AGGTCTTAGCTCTGTCGCCCAGG - Intronic
1198312092 X:135433889-135433911 CAGGGCCAGCTCTGTCACTCTGG - Intergenic
1198431517 X:136571436-136571458 CAGGGTCTTCTCTGTCACCCAGG + Intergenic
1198472067 X:136956330-136956352 GCGTCTTGGCTCTGTCACCCAGG - Intergenic
1198759147 X:140012580-140012602 GAGTCACGCCTCTGTCACCCTGG - Intergenic
1198779592 X:140220992-140221014 GAGTCACGCCTCTGTCACCCTGG + Intergenic
1199388635 X:147252962-147252984 CGGTGTCTCCTCTGTCACCCAGG + Intergenic
1199412296 X:147537971-147537993 GAGTCTCACCCTTGTCACCCAGG - Intergenic
1199973082 X:152875012-152875034 AAGTCCAAGCTCTATCACCCAGG - Intergenic
1200098701 X:153676963-153676985 GAGTCTCAGTCTTGTCACCCAGG + Intronic
1200765929 Y:7080589-7080611 CAGGGCCTGCTCTGTCACCCAGG - Intronic
1201156974 Y:11139716-11139738 GAGTCTCAACTTTGTCACCCAGG + Intergenic
1201317910 Y:12665715-12665737 GAGTCTCAGCTTTGTCTCCCAGG - Intergenic
1202190268 Y:22235167-22235189 CAGTGCAAGCTCTGTCTCCCGGG - Intergenic
1202589024 Y:26463427-26463449 GAGAATCTGCTCTGTCACCCAGG + Intergenic
1202601071 Y:26593532-26593554 CAGTCACAGCCCTGTCAGGCTGG + Intergenic