ID: 1114198371

View in Genome Browser
Species Human (GRCh38)
Location 14:20499482-20499504
Sequence TTTTATATGAATGAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114198367_1114198371 -2 Left 1114198367 14:20499461-20499483 CCCAGAAAGCCCAAACAGCACTT No data
Right 1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG No data
1114198368_1114198371 -3 Left 1114198368 14:20499462-20499484 CCAGAAAGCCCAAACAGCACTTT No data
Right 1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG No data
1114198366_1114198371 -1 Left 1114198366 14:20499460-20499482 CCCCAGAAAGCCCAAACAGCACT No data
Right 1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG No data
1114198365_1114198371 13 Left 1114198365 14:20499446-20499468 CCATCTGTTTAGGTCCCCAGAAA No data
Right 1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114198371 Original CRISPR TTTTATATGAATGAGAAGAA AGG Intergenic
No off target data available for this crispr