ID: 1114201880

View in Genome Browser
Species Human (GRCh38)
Location 14:20528888-20528910
Sequence ACTACCTCCTGCTCTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 7, 3: 13, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114201880_1114201881 -3 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201881 14:20528908-20528930 AGTCTTGATTTCTTCTTTTGAGG 0: 1
1: 1
2: 8
3: 53
4: 569
1114201880_1114201884 6 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201884 14:20528917-20528939 TTCTTCTTTTGAGGTGGGAGTGG 0: 1
1: 4
2: 8
3: 64
4: 528
1114201880_1114201882 0 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201882 14:20528911-20528933 CTTGATTTCTTCTTTTGAGGTGG 0: 1
1: 2
2: 8
3: 97
4: 2136
1114201880_1114201885 12 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201885 14:20528923-20528945 TTTTGAGGTGGGAGTGGAGACGG 0: 1
1: 0
2: 12
3: 82
4: 747
1114201880_1114201889 22 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201889 14:20528933-20528955 GGAGTGGAGACGGGCATTTGGGG 0: 1
1: 1
2: 2
3: 26
4: 217
1114201880_1114201886 13 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201886 14:20528924-20528946 TTTGAGGTGGGAGTGGAGACGGG 0: 1
1: 3
2: 8
3: 57
4: 518
1114201880_1114201887 20 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201887 14:20528931-20528953 TGGGAGTGGAGACGGGCATTTGG 0: 1
1: 0
2: 1
3: 22
4: 233
1114201880_1114201883 1 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201883 14:20528912-20528934 TTGATTTCTTCTTTTGAGGTGGG 0: 1
1: 1
2: 14
3: 112
4: 1549
1114201880_1114201888 21 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201888 14:20528932-20528954 GGGAGTGGAGACGGGCATTTGGG 0: 1
1: 0
2: 4
3: 21
4: 194
1114201880_1114201890 23 Left 1114201880 14:20528888-20528910 CCAGTCTCAGAGCAGGAGGTAGT 0: 1
1: 1
2: 7
3: 13
4: 147
Right 1114201890 14:20528934-20528956 GAGTGGAGACGGGCATTTGGGGG 0: 1
1: 2
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114201880 Original CRISPR ACTACCTCCTGCTCTGAGAC TGG (reversed) Intergenic
901008047 1:6181017-6181039 GCTCCTTCCTGCTCTGCGACAGG - Intergenic
902161586 1:14534865-14534887 TCTACCTTCTCCTCTGAGCCTGG + Intergenic
902627172 1:17683405-17683427 ACTGCCTCCTGCTCTCACCCGGG + Intronic
903853030 1:26319665-26319687 ACTGCTTCCTGCTTTGACACAGG - Intronic
905410182 1:37763342-37763364 ACTGCCTCCTCCTCTGACTCTGG + Intronic
907239637 1:53074401-53074423 ACTGCCTGCTCCTCTGAGCCTGG + Intronic
910394495 1:86778311-86778333 ACTGCCTCCTGCTCAGACATGGG - Intergenic
910896484 1:92075339-92075361 ACCACCTCCTGCTCTGGGACTGG - Exonic
911412316 1:97525105-97525127 ACTACCTCCTGGTCTAAGCATGG + Intronic
915023775 1:152806692-152806714 TCTGCCTCCAGCTGTGAGACAGG + Intronic
915025480 1:152825964-152825986 TCTGCCTCCAGCTGTGAGACAGG - Intergenic
917763588 1:178192765-178192787 AGTACTTCCTCCTCTGAGTCTGG + Intronic
917864795 1:179183891-179183913 ACCACCTCCTGTTCTGAGACTGG + Intronic
1063044509 10:2377918-2377940 AATAACTTCTGCTCTGAGAGAGG + Intergenic
1065009282 10:21407018-21407040 ACACCCTCCGTCTCTGAGACAGG - Intergenic
1065644002 10:27815587-27815609 ACTTCCTCCTTCTCTGCCACTGG + Intronic
1066233671 10:33464447-33464469 ACTGTCTCTTTCTCTGAGACAGG + Intergenic
1067535975 10:47110320-47110342 ACAGCCTCCTGCCCTGAGAAAGG - Intergenic
1069786085 10:70988815-70988837 ACTGCCTCCTACTCTGGGCCTGG + Intergenic
1072289100 10:93946236-93946258 ACCACCACCTGCTCAGAGCCTGG - Intronic
1074061386 10:109969275-109969297 ACGCCTGCCTGCTCTGAGACTGG - Intergenic
1074147088 10:110726254-110726276 ACCATCTCCAACTCTGAGACAGG - Intronic
1074237144 10:111596974-111596996 ACTAATTCCAGATCTGAGACAGG - Intergenic
1077217256 11:1400174-1400196 ACTCCCTCCTGCAGGGAGACTGG - Intronic
1078555126 11:12318890-12318912 TCTACCTCTTGTTCAGAGACTGG + Intronic
1083435614 11:62640943-62640965 ACTACCATTTCCTCTGAGACTGG - Intronic
1084455027 11:69263448-69263470 GCTACATCCTGCTCAGAGTCTGG + Intergenic
1084506293 11:69570389-69570411 TCTATCTCCTGCTCTCAGAGGGG + Intergenic
1086361559 11:86065550-86065572 CCCACCTCCAGCTGTGAGACAGG + Intronic
1087335496 11:96839379-96839401 GCTACCTCCTGCTCTGAATGTGG - Intergenic
1087587733 11:100143363-100143385 CCTACCTCCTACTCAGGGACTGG - Intronic
1089819748 11:121213628-121213650 ACTACAAACTGCTCTGACACTGG + Intergenic
1089973316 11:122711630-122711652 ACTACCTCATGCTGTGTAACGGG + Intronic
1091334782 11:134758224-134758246 CCTTCCTCCTTCTGTGAGACAGG + Intergenic
1091819159 12:3461647-3461669 AGGACTTCCTGCTCTGAGATAGG - Intronic
1092099975 12:5875018-5875040 GCTAACTCCTGCTCTAGGACAGG + Intronic
1092888621 12:12947938-12947960 ACTATTTCCTGCTCAGAGATGGG + Intronic
1095130869 12:38540878-38540900 ACTACCACCACCTCAGAGACAGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097505404 12:60461989-60462011 TCTACCTTCTGCCCTAAGACTGG + Intergenic
1098113402 12:67148254-67148276 ACTACCTCTTGCTATGACTCAGG - Intergenic
1098271183 12:68771710-68771732 ACTAGCTCCCGGGCTGAGACCGG - Exonic
1101436631 12:104669832-104669854 ACTTCCTCCTCCTGTGAGCCTGG + Intronic
1102013287 12:109632062-109632084 ACTGAGTCCTGCTCTGAGCCAGG - Intergenic
1102172369 12:110852157-110852179 ACTGACTCCTGCTCTAAGATGGG + Intronic
1103183879 12:118938970-118938992 ACTTCTTCCTGCTCTAAGACTGG - Intergenic
1106208145 13:27618727-27618749 ACTACCTCCACCTCGGACACTGG + Intronic
1108132907 13:47322657-47322679 AGTACCTCCTTCTGTGAGAGAGG + Intergenic
1108411129 13:50148249-50148271 ACTACCTCCTGCTCTGCAGCAGG + Intronic
1108967883 13:56334651-56334673 TCTTCTTCCTGCTCTGAAACTGG - Intergenic
1110030659 13:70608407-70608429 ACTCCCTCAGGCTTTGAGACAGG - Intergenic
1110074299 13:71219133-71219155 ACTAAGTCCTGTTCTGAGATCGG - Intergenic
1113085738 13:106567892-106567914 ACGAGCTCCGGCTCCGAGACCGG + Exonic
1114201880 14:20528888-20528910 ACTACCTCCTGCTCTGAGACTGG - Intergenic
1116601025 14:46922787-46922809 TCTTCTTCCTCCTCTGAGACTGG + Intronic
1117767895 14:59101879-59101901 TCTCCCTGCTTCTCTGAGACAGG + Intergenic
1118096472 14:62542977-62542999 ACTACCTTATGCTTTGAGATGGG - Intergenic
1121714933 14:96067075-96067097 AGTAACAGCTGCTCTGAGACTGG - Intronic
1121963956 14:98287448-98287470 ACTTCCTCCTGCTCTCAGGCAGG - Intergenic
1124149611 15:27165824-27165846 ACCACCTCCTCCTTTGCGACAGG - Intronic
1125549656 15:40536061-40536083 ACTCCCTCCAACCCTGAGACTGG - Intronic
1128334210 15:66775666-66775688 ACTACCCCCTGCTCAGGGCCTGG - Intronic
1130401157 15:83555569-83555591 ACCCCCTCCAGCTCTGTGACTGG - Intronic
1132594007 16:740114-740136 ACCACCTCCTGCTCAGTGCCCGG + Intronic
1137853194 16:51767110-51767132 CCTACCTACTGCTGTGAGGCTGG + Intergenic
1138416639 16:56875394-56875416 CTTAGCTCCTGCTCTGAGCCAGG - Intronic
1138530412 16:57631519-57631541 ACCACCTCCTCCTCCCAGACTGG + Intronic
1138919539 16:61510553-61510575 ACTGCCTCCTTCTCTGTGATTGG + Intergenic
1139556546 16:67714951-67714973 GCTAGCTCCTGCTCTTAGAAAGG - Intronic
1141368901 16:83469261-83469283 TCTTCCTCCTGCTATAAGACTGG - Intronic
1143101621 17:4507684-4507706 GCCACCTGCTGCTCTGAGACAGG + Intronic
1148149266 17:45386644-45386666 ACCAAGCCCTGCTCTGAGACTGG + Intergenic
1150043837 17:61891538-61891560 AGTATCTCCTGTTCTGTGACTGG + Exonic
1155728428 18:29119491-29119513 ACTACTTCACGCTCAGAGACTGG - Intergenic
1157343795 18:46804997-46805019 CCTACCTCATTCTCTGAAACTGG + Intergenic
1159289309 18:66395905-66395927 ACTACCGCCCGCTCTGAGTGCGG - Intergenic
1161090998 19:2360112-2360134 AGTACCTCCTGCTCCGGGCCGGG - Intergenic
1161706949 19:5826652-5826674 ACTGCCACCTGCTCTGGGGCTGG + Intronic
1162489947 19:10986094-10986116 ACCAGCTCCTACTCTGAGACAGG - Intronic
1163020262 19:14477831-14477853 CCTCCCTCCTGCTCTGGGCCAGG + Exonic
1163569081 19:18069633-18069655 AATACGTCATGCTCTGAGCCCGG + Exonic
1165894483 19:39133485-39133507 AGTTCCTCTTGCTCTGTGACGGG - Intronic
1166100670 19:40569764-40569786 CCTGCCTCCTGCTCTGAAAAAGG - Intronic
1167994600 19:53392268-53392290 ACTTCCTCCTCTTCAGAGACAGG - Intronic
928265206 2:29805491-29805513 CCTTCCTCCTGCTCCCAGACAGG + Intronic
929419063 2:41772431-41772453 TCTAGCGCCTGCTCTCAGACTGG - Intergenic
929861519 2:45682328-45682350 CCTACCTCGTACTCTCAGACAGG - Intronic
929945387 2:46367649-46367671 AGATCCTTCTGCTCTGAGACTGG + Intronic
931228406 2:60353220-60353242 ACTCCCTCCAGCTCTGGGAAAGG + Intergenic
932694610 2:73944905-73944927 TCTACCTCCAGCTCTTAGTCAGG + Intronic
934123608 2:88864679-88864701 ACTATCTCCTACACTGAAACAGG - Intergenic
934603635 2:95678143-95678165 GCAACCTCCTGCTCTGAAAGGGG + Intergenic
934973833 2:98786455-98786477 ACTGCCTCCTGCTCTGCCTCAGG + Intergenic
935157641 2:100497297-100497319 ACTTCCTCCTGATCTGAGGGTGG - Intergenic
935849086 2:107199245-107199267 ATTTCCTCCTGGTCTGAGATAGG + Intergenic
936537015 2:113320379-113320401 GCAACCTCCTGCTCTGAAACGGG + Intergenic
937098727 2:119252383-119252405 ACCCCCTCCTCCTCTGAGTCTGG + Intronic
938205776 2:129421733-129421755 ACTGGCTGCTGCTCTGAGATGGG + Intergenic
942572119 2:177325029-177325051 ACTAAGTCCTGCTATAAGACAGG + Intronic
947235378 2:227935991-227936013 AACAGCTCCTGTTCTGAGACTGG + Intergenic
947533061 2:230924888-230924910 ACTTCCTCCTGATCTGACTCAGG - Intronic
948803678 2:240443948-240443970 ACTCACTCCTGCTCTGGGCCTGG + Intronic
1175709335 20:61206516-61206538 TCTAGCTCCTGCTCAGAGTCTGG + Intergenic
1184457849 22:44621633-44621655 ACTGCCTCCTCCCCGGAGACTGG - Intergenic
1184947903 22:47817303-47817325 AACACCTCCTGCCCTGACACAGG + Intergenic
1185006067 22:48277690-48277712 ACCAGCCCCTGGTCTGAGACGGG + Intergenic
1185281115 22:49970310-49970332 ACTGTCTCCTGCTGTGAGACAGG + Intergenic
950433533 3:12965581-12965603 TCTGCCTCATGTTCTGAGACTGG + Intronic
957675984 3:83365174-83365196 ATTAGCTCCTGCTCTGTGAATGG - Intergenic
962211086 3:133478466-133478488 ATTTTCTCCTGCTCTGAGAGTGG + Intergenic
962743588 3:138381430-138381452 ACTACCTCCTGCTTTGGCCCAGG + Intronic
963957298 3:151269011-151269033 ACTACTTCCTGCTCTGAGACCGG + Intronic
964369737 3:155987354-155987376 ACCACCTCCTGCTCTGTGACCGG + Intergenic
965692452 3:171372094-171372116 ACTAACCCCAGCTCTGAGAGGGG - Intronic
968036916 3:195555315-195555337 CCTACCTCCTGCCCTGGGAGGGG - Intergenic
968433554 4:573609-573631 AGTACCTCCTGCCGTGGGACTGG - Intergenic
970937356 4:21588963-21588985 AGTATCTCCTACTCTGAGCCTGG + Intronic
972574330 4:40338210-40338232 AATGCCCCTTGCTCTGAGACCGG - Intronic
974717379 4:65685900-65685922 ACTACTTCCTGCTTTGGGAAGGG - Intergenic
976377158 4:84358678-84358700 AAGAACTCCTCCTCTGAGACTGG + Intergenic
982027074 4:151261495-151261517 ACAACCTCCTGCTGGGTGACTGG + Intronic
982303527 4:153904656-153904678 ACTATCTCTTGCATTGAGACTGG + Intergenic
982354990 4:154456515-154456537 ACTAGCTCCGTCTCTGAGAACGG + Intronic
985148746 4:186923056-186923078 ACTTCCTACTGCTGTGAGACTGG + Intergenic
985995350 5:3594587-3594609 ACCACCTCCTACGCAGAGACGGG - Intergenic
987787520 5:22521035-22521057 CCTACCTCCTGCCATGATACAGG - Intronic
990873601 5:60460667-60460689 AATGCCTCCTGCTCTGGGACCGG - Intronic
993846020 5:92944566-92944588 TCCAACTCCTGCTCTAAGACTGG + Intergenic
994207960 5:97057189-97057211 ACCACTTCCTGCTCTGGGACCGG - Intergenic
994207979 5:97057286-97057308 ACCACCTCCTGCTCTGGGACTGG - Intergenic
994403821 5:99317940-99317962 TATACCTCCTGCTCTGAGCAGGG - Intergenic
996884526 5:128339782-128339804 AGTCCCTCCTGCACAGAGACAGG - Intronic
998007188 5:138664902-138664924 ACTACCTCTTGCTCAGAGCATGG - Intronic
1000244503 5:159438190-159438212 ACAAGCTCCAGCTCTGAGACAGG - Intergenic
1000608547 5:163350446-163350468 GCTCCCTGCTGATCTGAGACTGG - Intergenic
1001673386 5:173492649-173492671 GCAACCTCCTGCTCTGAGCGGGG - Intergenic
1007687847 6:43677589-43677611 ACTACCTCCTCCCCAGAGATGGG - Intronic
1008530960 6:52458250-52458272 TTTTCCCCCTGCTCTGAGACAGG - Intronic
1009853346 6:69226978-69227000 ATTACCTCCTCCTCTGAATCTGG - Intronic
1010287265 6:74093342-74093364 ACTACCTCCAGCTCTGGGCTGGG + Intergenic
1013479080 6:110537527-110537549 TCTGCCTCCACCTCTGAGACTGG + Intergenic
1014250674 6:119112725-119112747 ACTATCTCAAGCTATGAGACAGG - Intronic
1022708593 7:32830655-32830677 CTCACCTCCTGCTGTGAGACTGG - Intergenic
1022914583 7:34934822-34934844 CTCACCTCCTGCTGTGAGACTGG + Intronic
1023472249 7:40536329-40536351 GATACCTTATGCTCTGAGACAGG + Intronic
1031450785 7:121915333-121915355 AATGCCCCTTGCTCTGAGACCGG + Intronic
1032127069 7:129202990-129203012 TCTATCTCCTGATCTGATACTGG - Intronic
1034840663 7:154392479-154392501 ACATCCTCCAGCTCTGAGACCGG + Intronic
1035029724 7:155849262-155849284 CCTCCCTCCTACTCTGAGATGGG + Intergenic
1042958314 8:74275818-74275840 CCCACCCCCTGCTCTGAGAATGG + Intronic
1046496070 8:115015107-115015129 ACCACCTCTTGCTCATAGACAGG - Intergenic
1049241363 8:141539002-141539024 ACTATCACCTGCTCTGCGCCAGG - Intergenic
1050116713 9:2271047-2271069 TCTGCCTCCTTCTCTGAGTCTGG - Intergenic
1051179112 9:14391882-14391904 ACTCACTTCTGCTCTAAGACTGG + Intronic
1052337247 9:27332592-27332614 AATAGCTTCTGCTCTGAAACTGG - Intronic
1058479244 9:105373964-105373986 ACTACCTCCAGCTCTGGGGATGG - Intronic
1061127085 9:128683946-128683968 ACCACCTCCTGCTCTGGGACCGG + Exonic
1186876802 X:13825501-13825523 ATTCCCTCCTCCTCTGTGACAGG - Intronic
1187074191 X:15917595-15917617 ACCACTTTCTCCTCTGAGACAGG + Intergenic
1189332242 X:40151409-40151431 ACTACCTCCTGGTGTAAGACAGG + Intronic
1189334848 X:40164929-40164951 ATTTCCTCCTTCTCTGAGCCAGG + Intronic
1189933448 X:46039490-46039512 ACCAGCTCCTTCTGTGAGACAGG - Intergenic
1192047848 X:67695293-67695315 ACTACCTTCAGCTCAGTGACAGG - Intronic
1192052838 X:67742870-67742892 GCTACATCCTGCTCTGAGACTGG - Intergenic
1193700518 X:84755186-84755208 ACCACCTCCTGCTCTGGGACCGG + Intergenic
1201175447 Y:11306397-11306419 ACTGCCTCCTTCACTGAGAGAGG + Intergenic
1201176718 Y:11314399-11314421 ACTGCCTCCTTCTCGGAGAGAGG + Intergenic