ID: 1114207431

View in Genome Browser
Species Human (GRCh38)
Location 14:20585950-20585972
Sequence ATGTAGGAGATCAATGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114207431 Original CRISPR ATGTAGGAGATCAATGTAGA AGG (reversed) Intronic
900609707 1:3539346-3539368 CTGTGGGAGATAAAAGTAGAGGG + Intronic
902857696 1:19221104-19221126 ATGAAAGAGAAAAATGTAGAAGG + Intronic
904768208 1:32866627-32866649 ATGTAGGAGAGCAGAGGAGAGGG - Intronic
906109342 1:43312685-43312707 CTGTAGGAGATTAATGGACATGG + Intronic
909953075 1:81743238-81743260 ATGTAGGGAATGAATGGAGAGGG + Intronic
910545506 1:88411873-88411895 TTGTTGGAGTTGAATGTAGAAGG - Intergenic
911641071 1:100289620-100289642 ATTAAGGAGATCAATCTATAAGG - Intronic
911921380 1:103765692-103765714 ATGTAGCACATCACTGTTGAGGG - Intergenic
912091478 1:106081388-106081410 ATGTATGAGGACAATTTAGAAGG - Intergenic
912579823 1:110710637-110710659 AGGTAGGACATCGATGTAGTTGG + Intergenic
913433602 1:118823451-118823473 ATGTAGGAAAAAAATGTAGATGG - Intergenic
915890712 1:159770895-159770917 ATGTAGGAGAGGCATGTATAAGG + Intergenic
917766539 1:178225493-178225515 ATGTAAGAGATAAATGTATATGG - Intronic
918690424 1:187472388-187472410 ATGTTGGAGAGCAATGTGCAAGG + Intergenic
919533337 1:198753126-198753148 ATAGAGTAGATCAATGTATATGG - Intronic
922334909 1:224611135-224611157 ATGTAGCAGATCTCTGGAGAGGG + Intronic
923070686 1:230561934-230561956 ATGTAGGTCATCCAGGTAGAGGG + Intergenic
924190863 1:241551384-241551406 ATGTACAAGAACAATCTAGAAGG + Intronic
1063035357 10:2281482-2281504 ATGTAAGAGATCAATGATGAGGG - Intergenic
1063848162 10:10154837-10154859 ATGTAGGAGGCCAAGGTAGGAGG + Intergenic
1064740153 10:18424655-18424677 ATGTAGAAAATAAATATAGATGG - Intronic
1066710010 10:38223338-38223360 GTGGAGGAGATGAATATAGAGGG - Intergenic
1067516042 10:46945486-46945508 ATGTAGGAAATCAGTGGAGATGG + Intronic
1067646205 10:48106324-48106346 ATGTAGGAAATCAGTGGAGATGG - Intergenic
1068501852 10:57849260-57849282 TTGTAGGAGATCAATTTACTAGG - Intergenic
1068928680 10:62566103-62566125 CTGTAGGAGATGATTGTACAGGG - Intronic
1073613052 10:104963676-104963698 AAGTAGAAGAGCAATGTACAAGG - Intronic
1075113358 10:119605743-119605765 CTTTGGGAGGTCAATGTAGAAGG + Intergenic
1076275047 10:129191650-129191672 ATGAAGGAGACAAAGGTAGAGGG - Intergenic
1078248013 11:9593976-9593998 ATTTAGGAAATCAATTTAGTAGG + Intergenic
1080446362 11:32341405-32341427 ATAGAGGAGAACAATGGAGATGG - Intergenic
1080507436 11:32929804-32929826 ATTTATTAGATTAATGTAGAAGG - Intronic
1083506611 11:63163691-63163713 ATGTATGAGGTCACTGTGGAAGG + Intronic
1084326514 11:68403477-68403499 CTGCAGGTGATCAATGTTGATGG + Exonic
1084842197 11:71863582-71863604 ATGAAGGAAAAAAATGTAGAAGG + Intergenic
1086632199 11:89036109-89036131 GTGTAGGAGATGAAACTAGAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1092094791 12:5832581-5832603 ATGTACGAGATCAAAGCAGGAGG - Exonic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1095522447 12:43084046-43084068 ATGAAAGACATCAATCTAGAAGG + Intergenic
1096407644 12:51355381-51355403 GTGGAGTAGAGCAATGTAGAAGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099406433 12:82269209-82269231 ATGTAGAAAATCAATGGTGAAGG + Intronic
1100477310 12:94946362-94946384 ATGTCAGAGATCCATGGAGAAGG - Intronic
1100538176 12:95531464-95531486 ATATAGGAAATCTATATAGAAGG - Intronic
1107220934 13:37978988-37979010 AGGTAGGAGATAAAAGTAGAAGG + Intergenic
1108290172 13:48951631-48951653 ATGTAGCAGGTCATTGTTGATGG + Intergenic
1109476528 13:62886707-62886729 ATTTAGGTGATTTATGTAGATGG + Intergenic
1113930724 13:113967600-113967622 ATGTAGGAGAAGGATGTAGGAGG + Intergenic
1114207431 14:20585950-20585972 ATGTAGGAGATCAATGTAGAAGG - Intronic
1114953407 14:27786054-27786076 ATCTAGGAGAGCCATGCAGAAGG - Intergenic
1115408497 14:33046538-33046560 ATGTAGGAGACAAGTGCAGAAGG + Intronic
1115456366 14:33608597-33608619 ATGTTGCAGACCAATGTAGTGGG + Intronic
1115505492 14:34090082-34090104 ATGAAGCAGATCAAGGTAGGAGG - Intronic
1117973492 14:61275475-61275497 AGTTAAGAGCTCAATGTAGAGGG + Intronic
1118130195 14:62954512-62954534 ATGTTGGGGATCAATTTGGAGGG + Intronic
1119238163 14:73036911-73036933 ATGTAGGAGATCTAGGCAGGAGG + Intergenic
1119598883 14:75961025-75961047 CTGTCGGAAGTCAATGTAGAGGG + Exonic
1119626283 14:76179193-76179215 ATGTATGAGATGATTTTAGATGG + Intronic
1120254153 14:82096829-82096851 ATCTAGGAGACCAAGGCAGATGG - Intergenic
1123777571 15:23595749-23595771 ATTTGGGAGATCAAGGCAGAAGG - Intronic
1124623237 15:31291720-31291742 CTTTAGGAGATCAATGCAGGTGG - Intergenic
1126588443 15:50314486-50314508 ATATGGTAGATTAATGTAGATGG + Intronic
1130559087 15:84944746-84944768 ATGTAGAGGATCCCTGTAGAGGG - Exonic
1131667689 15:94587750-94587772 ATGAAGGAGATGAAAGTAAATGG - Intergenic
1132041357 15:98526944-98526966 CTTTAGGAGGTCAAGGTAGAAGG - Intergenic
1140191559 16:72821426-72821448 ATGTGGGAACTCAATGGAGACGG - Intronic
1140915635 16:79490871-79490893 ATGTCAGAGATGAATGGAGAAGG + Intergenic
1142943520 17:3404224-3404246 AAAGAGGAGAACAATGTAGAAGG - Intergenic
1150295194 17:64003637-64003659 ATGTTGGAGATCTATGGTGAGGG - Exonic
1150873145 17:68937710-68937732 GTGTTGAAGATGAATGTAGAGGG + Intronic
1153480060 18:5538709-5538731 ATGGAGGACATCAGTGTGGAGGG - Intronic
1153798359 18:8646474-8646496 ATGAACGAGATCAATGCAGGAGG + Intergenic
1157006896 18:43593899-43593921 ATGTTGGAGATCATGGGAGAGGG + Intergenic
1159106825 18:64012399-64012421 ATGTAAAAGATCAATTCAGAGGG - Intergenic
930096014 2:47567770-47567792 ATGTAGGCAAGCAATGTAGGAGG - Intronic
930226481 2:48799417-48799439 ATCTGGGAGGTCAATGTGGAAGG + Intergenic
935621162 2:105130733-105130755 ATGTAATGGATCAATGCAGATGG + Intergenic
935863768 2:107362896-107362918 AAGTGGGAGATCAGAGTAGAAGG + Intergenic
937557135 2:123172105-123172127 TTTTAGGAGACCAAAGTAGATGG + Intergenic
939970454 2:148653363-148653385 CTGAAGGAGACCAATGCAGATGG + Intronic
941332058 2:164190776-164190798 AAGTAGGAGATAAATTTAGCAGG - Intergenic
941472616 2:165907624-165907646 AGGTAGGAGATGGATGCAGAAGG - Intronic
942173081 2:173306301-173306323 ATGAATGAGATCAATGCAAAGGG + Intergenic
943074316 2:183176086-183176108 ATCTAGGAAAACAATTTAGAAGG - Intergenic
944932361 2:204532736-204532758 CTGTAGGAGATAGATGTGGAAGG + Intergenic
947242264 2:228008259-228008281 ATGTAGGAGAAAAATCTAGATGG - Intronic
1170327374 20:15171425-15171447 AGGTAGGAGAGCAATGGTGAAGG - Intronic
1172596981 20:36156283-36156305 CTGGAGGAGATCAGTGCAGAGGG + Intronic
1175250451 20:57606618-57606640 TTGTTGGAGATTAATGTAGCTGG + Intronic
1176662531 21:9651713-9651735 AAGTAGGAAATCAATGCACATGG + Intergenic
1176932158 21:14826542-14826564 ATTTAGGAGATAATTTTAGAGGG - Intergenic
1177150620 21:17452064-17452086 ATGAGGGAGATCAATGCAGGAGG + Intergenic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
1182410094 22:30177687-30177709 CTATAGGAGATCAATTTATAAGG + Intergenic
1183429451 22:37756920-37756942 ATGTAGGAGACCAATGTCCCAGG - Intronic
951979312 3:28548158-28548180 ATTTTGGGGATTAATGTAGATGG + Intergenic
951981205 3:28568813-28568835 ATGTGGGAGATCATAGGAGAGGG + Intergenic
955444319 3:58993152-58993174 ATGTAGAAAATCAATATATACGG - Intronic
957319291 3:78608347-78608369 CTTTAGGAGATCAAAGTAGGTGG - Intronic
957348704 3:78995454-78995476 ATTTAAGAGATCACTTTAGAAGG - Intronic
958856266 3:99389988-99390010 ATAAAGGAGATCAATGTAACTGG + Intergenic
959367915 3:105487229-105487251 ATCTGGGAGATGGATGTAGATGG - Intronic
962953159 3:140239986-140240008 TTGTAGGATATCATTGCAGAGGG + Intronic
963301606 3:143603346-143603368 ATGTGAGAGAGGAATGTAGAGGG - Intronic
963461636 3:145621644-145621666 ATCTAGTAGATTAATGTTGAGGG - Intergenic
964078087 3:152716405-152716427 ATGGAGCAGAGCAATGTAGGGGG - Intergenic
964444422 3:156743931-156743953 ATGTAGGCCAGCAATGTAGGTGG + Intergenic
966373908 3:179276128-179276150 ATGTAGGACAAGAATGGAGAGGG - Intergenic
972030540 4:34451707-34451729 ATGAAGGTGAACAATGAAGAAGG - Intergenic
973756737 4:54082180-54082202 ATTTTTGAGATCCATGTAGATGG - Intronic
974439618 4:61899306-61899328 AGGTAGGAGATCAGAGCAGAAGG - Intronic
975451202 4:74529039-74529061 ATTTAGGACTTAAATGTAGAGGG - Intergenic
976878773 4:89891953-89891975 ATTGAGGAGTTCACTGTAGATGG - Intronic
978598639 4:110405193-110405215 ATGCAGGAGATCAATGAATTAGG - Intronic
979970890 4:127133685-127133707 TTGTAGGTTATCAATGGAGAAGG - Intergenic
982068316 4:151673546-151673568 CTGTAGGAGATGAATGTGGTAGG - Intronic
985412864 4:189704812-189704834 AAGTAGGAAATCAATGCACATGG - Intergenic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
993911223 5:93687157-93687179 ATGTATGAGATAAATATAAATGG + Intronic
999914886 5:156247579-156247601 ATGTGGGAGATAAATATAGCAGG + Intronic
1000576568 5:162982358-162982380 ATGTTGAATATCAATGGAGAAGG - Intergenic
1002013006 5:176299148-176299170 CTTTGGGAGACCAATGTAGAAGG + Intronic
1002214834 5:177623594-177623616 CTTTGGGAGACCAATGTAGAAGG - Intergenic
1009386817 6:63094621-63094643 ATGAATGAGAGCAATGTAAATGG + Intergenic
1011265569 6:85514532-85514554 ATGGAGGTGATGACTGTAGAAGG - Exonic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1014023870 6:116621304-116621326 ATATGGGAGATCAATGTAAAGGG - Intronic
1019827976 7:3300283-3300305 ATGTAAGAGATGAACGCAGAGGG - Intergenic
1020618016 7:10484155-10484177 ATGTAGGTGATAAATTTGGAGGG - Intergenic
1020843932 7:13258905-13258927 ATGGAGGAGATCAATACAAATGG - Intergenic
1024087404 7:45906592-45906614 ATGCTGAAGATCAAAGTAGAAGG + Intergenic
1024993033 7:55251212-55251234 TTGTAGGTGTTCAGTGTAGAGGG - Intronic
1025270444 7:57507773-57507795 ATGAAGGTGAACAATGAAGAAGG + Intergenic
1028280829 7:88925931-88925953 ATGCAGGAGAATAAAGTAGAAGG + Intronic
1029406354 7:100376243-100376265 ATGTAGGAAATCAAAGTTCAAGG - Intronic
1030375463 7:108748199-108748221 AAGTAGGAGACCAGGGTAGAAGG + Intergenic
1030442998 7:109612570-109612592 CTTTAGGAGATCAAGGTAGGAGG - Intergenic
1030578377 7:111319339-111319361 ATGTAGCACATTAGTGTAGAAGG - Intronic
1031470836 7:122167360-122167382 ATGTTGGAGATTAATGAAAAAGG - Intergenic
1038109725 8:24482502-24482524 TTTTAGGAGACCAAAGTAGAAGG + Intronic
1039074504 8:33677646-33677668 AAGTAGGATAACTATGTAGAAGG - Intergenic
1039196502 8:35037751-35037773 ATGTAGGAGAAAAATCTAGATGG + Intergenic
1044997076 8:97847562-97847584 CTATAGGAGATCAATGAACATGG - Intronic
1045656249 8:104390210-104390232 ATCTAGGAGATGAACATAGAGGG - Intronic
1046669321 8:117040851-117040873 ATTCAGGAGATCTATGTATAGGG - Intronic
1047137258 8:122093996-122094018 CTTTAGGAGGCCAATGTAGACGG + Intergenic
1048067026 8:130980447-130980469 ATGCAGGAGAGAAATGGAGAAGG + Intronic
1052448261 9:28591598-28591620 GTGTGGGAGGTCAATTTAGATGG + Intronic
1052466980 9:28840845-28840867 ATGTATGAGATGAAGGTAAAGGG - Intergenic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1058638751 9:107062559-107062581 ATCTAGGACATCTATATAGAAGG - Intergenic
1059946189 9:119410777-119410799 TTGGGGGAGAACAATGTAGAAGG - Intergenic
1060671123 9:125470734-125470756 ATGTAGGAGATGAATGCAATAGG + Intronic
1185993457 X:4916950-4916972 ATGTAGGGGCAGAATGTAGAAGG - Intergenic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1189383265 X:40516946-40516968 AGGTAGGAGATCAGAGTAGTGGG + Intergenic
1190148913 X:47924561-47924583 TGGTAGAAGATGAATGTAGAAGG - Intronic
1191816603 X:65252691-65252713 CTGTATTAGATCAATGTAAATGG - Intergenic
1193424730 X:81328110-81328132 ATGTAGGACATCGATGTCAAAGG + Intergenic
1193547325 X:82846085-82846107 ATCTACTAGAGCAATGTAGAGGG + Intergenic
1195087366 X:101425041-101425063 ATGCAGGAGATCAAAGAAGGAGG + Intronic
1197388936 X:125837067-125837089 ATGTAGTATATCACTGTTGATGG - Intergenic
1201906904 Y:19094807-19094829 AACAAGGATATCAATGTAGATGG + Intergenic