ID: 1114213887

View in Genome Browser
Species Human (GRCh38)
Location 14:20640933-20640955
Sequence GAGGGTCACCACTATCAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114213880_1114213887 24 Left 1114213880 14:20640886-20640908 CCACTCTGCGATGGCCGCACATA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1114213887 14:20640933-20640955 GAGGGTCACCACTATCAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83
1114213882_1114213887 10 Left 1114213882 14:20640900-20640922 CCGCACATAGAGAAAAATGGCAC 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1114213887 14:20640933-20640955 GAGGGTCACCACTATCAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114213887 Original CRISPR GAGGGTCACCACTATCAAGT GGG Exonic
901872612 1:12146889-12146911 GAGGGCCACCACTAGCTAGGTGG + Intergenic
903797589 1:25941502-25941524 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
904937138 1:34139358-34139380 GAGAGTCCCCACTAGCAAGAAGG + Intronic
924830511 1:247589096-247589118 GATGGTGACCACTGTCAGGTGGG - Exonic
1063327600 10:5120380-5120402 TAGGGTCTCCACGATCAAGCTGG + Intronic
1064472474 10:15650538-15650560 GAGGGTCCCCACCAGCAAGAAGG + Intronic
1072486748 10:95863290-95863312 GGGGCTCAGCACTTTCAAGTTGG + Intronic
1074214370 10:111369863-111369885 GATGGTCACAACTATGGAGTTGG - Intergenic
1083305634 11:61760795-61760817 GAGGGTCATAGCCATCAAGTGGG + Intronic
1088162214 11:106886092-106886114 GAGAGCCACCACTATTAAGTGGG + Intronic
1095463693 12:42468194-42468216 GAGGGTAACTACTATTAATTTGG + Intronic
1105324018 13:19353851-19353873 GAGGCTCACTGCTATCAAGGTGG - Intergenic
1105869963 13:24495911-24495933 GAGGCTCACTGCTATCAAGGTGG + Intronic
1108939117 13:55927887-55927909 GAAGTTCAACATTATCAAGTTGG + Intergenic
1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG + Intergenic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1114213887 14:20640933-20640955 GAGGGTCACCACTATCAAGTGGG + Exonic
1114333807 14:21665807-21665829 GAGGGCAACCACCATGAAGTGGG - Exonic
1115636234 14:35292531-35292553 GAGGGTCGGCTCTACCAAGTAGG + Exonic
1118676213 14:68187432-68187454 GGGTGTCACCACTAACAAGCAGG - Intronic
1122780858 14:104142864-104142886 GGGGGTGACCACCAGCAAGTGGG - Intronic
1127626298 15:60783561-60783583 GAGGGTCACCAAGATCACGCTGG + Intronic
1128165059 15:65456879-65456901 TATTGTCAACACTATCAAGTTGG + Intronic
1132024753 15:98395581-98395603 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1135037879 16:19093406-19093428 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1137318533 16:47353227-47353249 AAGAATCACCACGATCAAGTGGG + Intronic
1139345388 16:66299867-66299889 GAGGGTCCCCACCAGCAAGAAGG - Intergenic
1142078304 16:88133039-88133061 GAGGGTCACCACACACAGGTTGG + Intergenic
1152777133 17:82209198-82209220 GAGGGGCACCACTACCACGAAGG + Intronic
1156253163 18:35371518-35371540 GAGGGTCTCCACCAGCAAGAAGG - Intronic
1156976066 18:43222583-43222605 GAGGGTCTCCATTAGCAAGAAGG - Intergenic
1157636563 18:49162353-49162375 GAGAGTCACCACTAGCAAGAAGG - Intronic
1161208465 19:3054275-3054297 GAGGAGCCCCACTACCAAGTGGG + Intronic
1161939071 19:7391355-7391377 GTGGGTCTCCACGATAAAGTTGG + Intronic
926475822 2:13320921-13320943 GATGGCCACAACTATCAGGTTGG + Intergenic
926565870 2:14473144-14473166 CTAGTTCACCACTATCAAGTAGG + Intergenic
927066638 2:19478295-19478317 GAGGGTCCCCACCAGCAAGGAGG - Intergenic
929571102 2:43023644-43023666 GAGGGTCCCCGTTACCAAGTAGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
936484048 2:112911435-112911457 GAGGGCTTCCACTAACAAGTAGG + Intergenic
939301500 2:140347090-140347112 GAGGGGAAGCACTATAAAGTAGG - Intronic
940992250 2:160109699-160109721 GAGGGTCACCTCTATCACTGTGG + Intronic
941048890 2:160708853-160708875 GAAATTCACCACAATCAAGTAGG - Intergenic
942826781 2:180187282-180187304 GAGAGTCACCATTATGCAGTTGG + Intergenic
948239317 2:236416381-236416403 GAGTGTCAGCACTGTCATGTGGG + Intronic
1170470366 20:16662586-16662608 CAGGGTCACCCCCATCATGTTGG + Intergenic
1172792177 20:37513362-37513384 GAGGGTCACCACTACCAGTGTGG + Intronic
1178180258 21:30152123-30152145 GAGAATCACCACGATAAAGTTGG + Intergenic
1178834957 21:36089071-36089093 GAGAGTCTCCACCAGCAAGTAGG + Intergenic
1178838990 21:36123469-36123491 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1179325928 21:40345378-40345400 GAGAGACACCAAAATCAAGTTGG - Intronic
1180097797 21:45567872-45567894 GAGGGTCCCCACTAGCAAGAAGG - Intergenic
1181018415 22:20084871-20084893 GTGGGTCTCCCCTCTCAAGTAGG + Intronic
1184428945 22:44429929-44429951 GAGGGCCAGCACTATCAAGAGGG + Intergenic
961371509 3:126434535-126434557 GAGGGGCATCACAGTCAAGTGGG + Intronic
963782630 3:149502179-149502201 GAAAGCCACCACTAACAAGTAGG - Intronic
966900705 3:184482026-184482048 GAGAGTCACCACCAGCAAGAAGG - Intronic
967256844 3:187602013-187602035 GAAGGTCACCACTATAAGCTGGG + Intergenic
967524677 3:190477331-190477353 GATATTCACCACGATCAAGTGGG + Intergenic
979399047 4:120225195-120225217 GATGGTGACCACCATCAAGAAGG - Intergenic
980709358 4:136544097-136544119 GAGGGTAACCAATATCAGGAAGG - Intergenic
983924271 4:173381030-173381052 GAGGGTCAAGACTATTCAGTTGG - Intergenic
984882710 4:184424611-184424633 GAGGGTCCCCACCAGCAAGAAGG + Intronic
990828640 5:59931465-59931487 GAGGGTCCCCACCAGCAAGAAGG - Intronic
1005772350 6:29086499-29086521 GAGGGACACCACAATCATGTGGG + Exonic
1005784512 6:29229410-29229432 GAGGGACACTACTATCAAATGGG + Intergenic
1006250205 6:32777211-32777233 GAGGGTCCCCACTAGCAAGGAGG - Intergenic
1007887065 6:45241670-45241692 TAGGGTCTCCACGATCAAGCTGG + Intronic
1012450774 6:99350523-99350545 GAGGTTCATCACTCTCAAGGTGG + Intergenic
1013357228 6:109356755-109356777 GAGGGTCCCCACCAGCAAGAAGG + Intergenic
1014948829 6:127530245-127530267 GAGGGTCCCCACCAGCAAGAAGG - Intronic
1015049201 6:128818448-128818470 GTGGGCCAGCACTATCAAATTGG + Intergenic
1022127084 7:27368916-27368938 GGGGGTCACCTCTCTCAAGAGGG + Intergenic
1024241282 7:47438509-47438531 GAGAGGCACCACCATCAAATGGG + Intronic
1024611962 7:51073836-51073858 CAGTGTCACCATTATCAAGATGG - Intronic
1028445937 7:90924160-90924182 GAGAGTCCCCACTAACAAGAAGG - Intronic
1029421973 7:100476601-100476623 GAGGGTGACCACTGTGGAGTGGG - Intronic
1035724132 8:1813998-1814020 GAGGGCCACGACTCTCATGTGGG - Intergenic
1041544372 8:59025420-59025442 GAGGCTCACCATTATCCAATCGG + Intronic
1042941685 8:74114661-74114683 GAGGCTCTCCACAATCAGGTGGG - Intergenic
1043294216 8:78644476-78644498 CAGGGTCACCACTTGCAGGTTGG - Intergenic
1043811729 8:84750790-84750812 TAGGGTCCCCACTAGCAAGAAGG + Intronic
1054924708 9:70577776-70577798 GGGGGACACCACTATCAAACAGG - Intronic
1055785068 9:79863207-79863229 GAGGGTCACCCTTGTCATGTGGG - Intergenic
1056642499 9:88383328-88383350 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1056735430 9:89205693-89205715 CAGGGTCACCACTATCACAGTGG + Intergenic
1057914196 9:99043192-99043214 GAGGGCCTCCAATATCTAGTGGG + Intronic
1185664383 X:1753379-1753401 GAGAGTCCCCACTAGCAAGAAGG - Intergenic
1193899075 X:87153121-87153143 GGAATTCACCACTATCAAGTAGG - Intergenic
1197925160 X:131638420-131638442 GATGGTCATCACTATGTAGTTGG - Intergenic
1199997579 X:153035767-153035789 GAGAGTCCCCACCATCAAGAAGG + Intergenic
1200918161 Y:8589675-8589697 GAGGGTCTCCTCCATGAAGTGGG - Intergenic