ID: 1114214125

View in Genome Browser
Species Human (GRCh38)
Location 14:20642947-20642969
Sequence ATTAAGGCCCATCGTTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114214125_1114214132 15 Left 1114214125 14:20642947-20642969 CCAGTAAAACGATGGGCCTTAAT No data
Right 1114214132 14:20642985-20643007 CCTTCAGGTGCACTAAGATAGGG 0: 44
1: 50
2: 36
3: 26
4: 97
1114214125_1114214133 26 Left 1114214125 14:20642947-20642969 CCAGTAAAACGATGGGCCTTAAT No data
Right 1114214133 14:20642996-20643018 ACTAAGATAGGGAAGCTGAATGG No data
1114214125_1114214130 14 Left 1114214125 14:20642947-20642969 CCAGTAAAACGATGGGCCTTAAT No data
Right 1114214130 14:20642984-20643006 CCCTTCAGGTGCACTAAGATAGG 0: 45
1: 49
2: 40
3: 31
4: 73
1114214125_1114214127 0 Left 1114214125 14:20642947-20642969 CCAGTAAAACGATGGGCCTTAAT No data
Right 1114214127 14:20642970-20642992 AAGCACCTTTCTTTCCCTTCAGG No data
1114214125_1114214134 27 Left 1114214125 14:20642947-20642969 CCAGTAAAACGATGGGCCTTAAT No data
Right 1114214134 14:20642997-20643019 CTAAGATAGGGAAGCTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114214125 Original CRISPR ATTAAGGCCCATCGTTTTAC TGG (reversed) Intergenic
No off target data available for this crispr