ID: 1114216517

View in Genome Browser
Species Human (GRCh38)
Location 14:20661347-20661369
Sequence TTGGTCATCAGCAAAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114216517_1114216525 29 Left 1114216517 14:20661347-20661369 CCCACACTTTTGCTGATGACCAA No data
Right 1114216525 14:20661399-20661421 TCCCTCAAAGCACCAAGCCTAGG No data
1114216517_1114216519 -9 Left 1114216517 14:20661347-20661369 CCCACACTTTTGCTGATGACCAA No data
Right 1114216519 14:20661361-20661383 GATGACCAAACACCACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114216517 Original CRISPR TTGGTCATCAGCAAAAGTGT GGG (reversed) Intergenic
No off target data available for this crispr