ID: 1114216517 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:20661347-20661369 |
| Sequence | TTGGTCATCAGCAAAAGTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114216517_1114216525 | 29 | Left | 1114216517 | 14:20661347-20661369 | CCCACACTTTTGCTGATGACCAA | No data | ||
| Right | 1114216525 | 14:20661399-20661421 | TCCCTCAAAGCACCAAGCCTAGG | No data | ||||
| 1114216517_1114216519 | -9 | Left | 1114216517 | 14:20661347-20661369 | CCCACACTTTTGCTGATGACCAA | No data | ||
| Right | 1114216519 | 14:20661361-20661383 | GATGACCAAACACCACTCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114216517 | Original CRISPR | TTGGTCATCAGCAAAAGTGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||