ID: 1114219464

View in Genome Browser
Species Human (GRCh38)
Location 14:20683760-20683782
Sequence CTTGTGTCTCACTGAGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114219464_1114219470 30 Left 1114219464 14:20683760-20683782 CCCCGGGCTCAGTGAGACACAAG No data
Right 1114219470 14:20683813-20683835 CCTTCACCCCATCCTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114219464 Original CRISPR CTTGTGTCTCACTGAGCCCG GGG (reversed) Intergenic
No off target data available for this crispr