ID: 1114221923

View in Genome Browser
Species Human (GRCh38)
Location 14:20704412-20704434
Sequence GGGGAGTGCTAGTGTGGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114221923_1114221931 21 Left 1114221923 14:20704412-20704434 CCGCTTCCACACTAGCACTCCCC No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114221923 Original CRISPR GGGGAGTGCTAGTGTGGAAG CGG (reversed) Intergenic
No off target data available for this crispr