ID: 1114221931

View in Genome Browser
Species Human (GRCh38)
Location 14:20704456-20704478
Sequence TTACACACAGCTGAAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 10, 1: 9, 2: 82, 3: 146, 4: 360}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114221922_1114221931 29 Left 1114221922 14:20704404-20704426 CCTGGAGACCGCTTCCACACTAG No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221926_1114221931 1 Left 1114221926 14:20704432-20704454 CCCGACTCGTCCCATTCTTTTTC No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221929_1114221931 -10 Left 1114221929 14:20704443-20704465 CCATTCTTTTTCCTTACACACAG No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221928_1114221931 -9 Left 1114221928 14:20704442-20704464 CCCATTCTTTTTCCTTACACACA No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221923_1114221931 21 Left 1114221923 14:20704412-20704434 CCGCTTCCACACTAGCACTCCCC No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221925_1114221931 2 Left 1114221925 14:20704431-20704453 CCCCGACTCGTCCCATTCTTTTT No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221924_1114221931 15 Left 1114221924 14:20704418-20704440 CCACACTAGCACTCCCCGACTCG No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221927_1114221931 0 Left 1114221927 14:20704433-20704455 CCGACTCGTCCCATTCTTTTTCC No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360
1114221921_1114221931 30 Left 1114221921 14:20704403-20704425 CCCTGGAGACCGCTTCCACACTA No data
Right 1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG 0: 10
1: 9
2: 82
3: 146
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114221931 Original CRISPR TTACACACAGCTGAAATACA AGG Intergenic
900823200 1:4905849-4905871 TTACTCACAGTTTAAATAAAAGG - Intergenic
902051119 1:13564227-13564249 TTACACATAGCCGAAGTGCAGGG + Intergenic
902084477 1:13848521-13848543 TTAGCCACAGCTGGAATGCAGGG - Intergenic
902857307 1:19217550-19217572 TTGATTACAGCTGAAATACAGGG + Exonic
904839408 1:33362458-33362480 TTATAGACAGCTGAAATGTATGG + Intronic
905060280 1:35134308-35134330 TTACACACAGCTGAAGTGCAGGG - Intergenic
905429481 1:37911014-37911036 TTACACACAGCTGAAGTGCAGGG + Intronic
908670692 1:66544364-66544386 TTTCCCAAAGTTGAAATACAGGG + Intronic
908762032 1:67521600-67521622 TGACAAACAGTAGAAATACAAGG - Intergenic
908905797 1:69007453-69007475 TTATACACAGTTGAATTAAATGG - Intergenic
909014968 1:70371146-70371168 TTACACACAGCTGAAGTGCAGGG + Intronic
909491218 1:76228758-76228780 TCACACTCAGCTAAAATAAAAGG - Intronic
909854676 1:80513631-80513653 TTGCTCACAGATGAAATACAGGG + Intergenic
910947141 1:92606065-92606087 TAACACACAGCTTAAACACAGGG + Intronic
911071384 1:93834506-93834528 TTACACACAGCTGAAGTGCAGGG + Intronic
911510393 1:98803233-98803255 TTACCCACAGCTGAAATGCAGGG - Intergenic
911868505 1:103059900-103059922 TTACACACAATAGGAATACAAGG + Intronic
911967187 1:104384087-104384109 TTACACTTAGCTGAAGTGCAGGG + Intergenic
911984069 1:104599708-104599730 TTACACACAGCCAAAGTGCAGGG + Intergenic
912815065 1:112822501-112822523 TTACACACAACCGAAGTGCAGGG - Intergenic
912939139 1:114029675-114029697 TTACATACAGCCAAAATGCAAGG + Intergenic
913095510 1:115512363-115512385 TTACATACAGCTGAAGTGCAGGG - Intergenic
913245392 1:116865999-116866021 TTACACACAGCCGAAGTGCAGGG + Intergenic
913394937 1:118357096-118357118 CCACAAACAGCAGAAATACATGG + Intergenic
916001505 1:160620734-160620756 TTGCACAGAGCTGATCTACAGGG - Intronic
917749897 1:178043712-178043734 TTACACACAGCCAAACTACAGGG + Intergenic
919277497 1:195439835-195439857 TTATCCACAGCTGGAATGCAGGG + Intergenic
919577463 1:199329422-199329444 TCATACGCAGCTGAAATAAATGG - Intergenic
920901338 1:210113161-210113183 TTACACACAGCCGAAGTGCAGGG - Intronic
920908251 1:210191007-210191029 TTACACACAGCCAAAGTACAGGG + Intergenic
921205349 1:212844069-212844091 TTACACACAGCCAAAGTGCAGGG + Intronic
921956270 1:220986637-220986659 TTACACAGAGGTGAAATCAAGGG - Intergenic
922046668 1:221951812-221951834 TTACACACAGCTGAAATACAAGG + Intergenic
922368761 1:224889340-224889362 TTACATACGGCTGAAATACATGG + Intergenic
922845162 1:228678987-228679009 TTACACACAGCCGAAGTGCAGGG - Intergenic
923683725 1:236140268-236140290 TTGTACACAGCTGAAAGCCATGG - Intergenic
923823536 1:237474116-237474138 CTACACACAGCTGACAGTCAGGG - Intronic
923952665 1:238976133-238976155 TTTCAGACATCTGAAAAACAAGG - Intergenic
924180900 1:241437701-241437723 TTACACACAGCTGAAGTGCAGGG + Intergenic
924860950 1:247921604-247921626 TAACACACAGCAGATGTACATGG - Exonic
924874246 1:248083987-248084009 TAACACACAGCAGATGTACATGG + Intronic
924890477 1:248273206-248273228 TAACACACAGCAGATGTACATGG + Exonic
924892127 1:248294970-248294992 TAACACACAGCAGATGTACATGG + Exonic
1062930991 10:1352460-1352482 TTACCCACAGCTGAAGTGCAGGG + Intronic
1063363393 10:5474841-5474863 TGACACACAGCCGAAGTGCAGGG + Intergenic
1064956836 10:20920846-20920868 TTATACTAAGCTGAAATAAATGG + Intronic
1065437863 10:25720181-25720203 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1066103199 10:32136015-32136037 TTACACACAGCCGAAGTACAGGG - Intergenic
1066436944 10:35404323-35404345 TTACACACAGCCAAAGTGCAGGG - Intronic
1067126529 10:43521162-43521184 TTGCTCCCAGATGAAATACAGGG + Intergenic
1068128405 10:52868579-52868601 TTAGCCACAGCTGGAATGCAGGG - Intergenic
1068179416 10:53501012-53501034 TTACACACAGCAGAAGTGCAGGG - Intergenic
1068972531 10:62974641-62974663 TTAGCCACAGCTGGAATGCAGGG + Intergenic
1070389303 10:75954897-75954919 ATATACATAGGTGAAATACATGG - Intronic
1070456254 10:76620148-76620170 TTAGCCACAGCTGAGACACAGGG + Intergenic
1070983932 10:80672066-80672088 TTGCCCACAGCTGATATTCAAGG - Intergenic
1071187500 10:83061055-83061077 TTACACACAGCCGAAGTGCAGGG + Intergenic
1071550589 10:86563588-86563610 TTACACACAGCCAAAGTACAGGG - Intergenic
1071821977 10:89288438-89288460 TTACACACAGCGAAAGTACAGGG + Intronic
1071961349 10:90811137-90811159 TTACACAGAGCTGAAGTGCAGGG + Intronic
1073014218 10:100385124-100385146 TTACACACAGCCAAAGTGCAGGG + Intergenic
1073130681 10:101187188-101187210 TTACACACAGCTGAAGTGCAGGG - Intergenic
1073394945 10:103209789-103209811 TTACACACAGCCAAACTACAGGG + Intergenic
1073683717 10:105730736-105730758 TTACACACAGCTGAAGTACAGGG + Intergenic
1073724313 10:106212085-106212107 TTACACACTGCTGAAAAGAATGG + Intergenic
1074001281 10:109375978-109376000 GTACCCACAGCTGAAAAACCTGG - Intergenic
1074254724 10:111789832-111789854 ATACACAAGGCTTAAATACATGG - Intergenic
1074512776 10:114132922-114132944 TCAACTACAGCTGAAATACAAGG + Intronic
1075014143 10:118897753-118897775 TTACACACAGCTGAAGAGCAGGG + Intergenic
1075482405 10:122793435-122793457 TTTCATAGATCTGAAATACATGG - Intergenic
1075983220 10:126759200-126759222 TCACCCACAGGGGAAATACAGGG + Intergenic
1076170370 10:128314394-128314416 TTACACACAGCTTAAATACACGG - Intergenic
1077192119 11:1259950-1259972 TTTCATTCAGCTGAAATGCAAGG - Exonic
1077636476 11:3845011-3845033 TTACAAGCAGCTGAGAGACAAGG + Intergenic
1078128273 11:8589918-8589940 TTCCAAACAGCTGAAATATTGGG - Intronic
1078789256 11:14526352-14526374 TTACACACAGCCAAAGTGCAGGG + Intronic
1079847449 11:25489204-25489226 TTACCCACAGCTGAAGTGCAGGG - Intergenic
1080308207 11:30859722-30859744 AAAGACCCAGCTGAAATACATGG - Intronic
1080620274 11:33981515-33981537 TTGAGCACTGCTGAAATACAGGG - Intergenic
1081159963 11:39738295-39738317 TTACACACAGCTGAAGTGCAGGG + Intergenic
1081996815 11:47370763-47370785 TTACTCACAGCTGAGCCACATGG - Intronic
1082197520 11:49323403-49323425 TTACACACAGCCAAAGTACAGGG - Intergenic
1083517651 11:63275345-63275367 TTACAGAAGGCTGAAATACTAGG + Intronic
1084484730 11:69441476-69441498 TTACAAACTGCTGAACTAGAAGG + Intergenic
1084585699 11:70060820-70060842 TTACACACAGCTGAAATCCAAGG - Intergenic
1084613049 11:70216314-70216336 TTACACACAGCCAAAGTGCAGGG - Intergenic
1085570452 11:77553769-77553791 TTACACACAGCTGAAGTGCAGGG + Intronic
1085627529 11:78084661-78084683 TTACACACAGCTGAAGTACAGGG + Intergenic
1085871477 11:80355370-80355392 TTTTATACAGCTGAAATACAGGG + Intergenic
1085988247 11:81809936-81809958 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1086133345 11:83422466-83422488 TTACACACAGCTGAAGTGCAGGG + Intergenic
1086134598 11:83433589-83433611 TTACCCACAGCTGAAGTGCAGGG - Intergenic
1086136036 11:83444885-83444907 TTACCCACAGCTGAAGTGCAGGG - Intergenic
1086504688 11:87493116-87493138 TTGTACACAGCTGAAATAGTGGG - Intergenic
1086550443 11:88046913-88046935 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1086658302 11:89384724-89384746 TTACACACAGCCAAAGTACAGGG + Intronic
1086841158 11:91685965-91685987 TTACACACAGATGCAATAATAGG - Intergenic
1087099874 11:94353360-94353382 TTACACACAGCCGAAGTGCAGGG + Intergenic
1087107100 11:94421678-94421700 TAAACCACAGCTTAAATACAGGG + Intronic
1087167834 11:95022479-95022501 TTACACACAGCCAAAGTGCAGGG - Intergenic
1087179867 11:95131289-95131311 CTTCACACTGCTGAAATAAAGGG - Exonic
1087839304 11:102906066-102906088 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1088555192 11:111053919-111053941 TTACACACAGCCAAATTGCAGGG + Intergenic
1089221105 11:116872687-116872709 TTAAACACATATAAAATACAAGG - Intronic
1089953573 11:122550847-122550869 TTACACACAGCTGAAGTACAGGG + Intergenic
1090107365 11:123867562-123867584 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1090526574 11:127544719-127544741 TTACACACAGCCGAAGTGCCGGG - Intergenic
1090546261 11:127771062-127771084 TTACACACAGCTGAAGTGCAGGG - Intergenic
1091183917 11:133630523-133630545 TTACACACAGCAGAAGTGCAGGG + Intergenic
1091542412 12:1474012-1474034 TTTCACACAACTGGAATAAATGG - Intronic
1092924583 12:13261780-13261802 TTACACACAGCCGAAGTGCAGGG - Intergenic
1093126432 12:15334336-15334358 TTATACTCAGTTGAAATACTAGG + Intronic
1093139256 12:15488718-15488740 TTAGAGAAAGCTGAAAAACATGG + Intronic
1093302557 12:17473826-17473848 TTACATGCAGCTGAAATATAAGG + Intergenic
1093344726 12:18026613-18026635 TTCAAAACAGCTCAAATACATGG + Intergenic
1093358693 12:18198843-18198865 TTACACACAGCTGAAGTGCAGGG + Intronic
1093812598 12:23508010-23508032 TTACCCACAGCAGAAGTGCAGGG - Intergenic
1094315811 12:29136967-29136989 TTACCCACAGCTGAAGTGCAGGG - Intergenic
1094400916 12:30059708-30059730 TTACCCACAGCTGAAGTGTAGGG + Intergenic
1094825999 12:34269519-34269541 TTACACACAGCTGAAGTGCAGGG + Intergenic
1095806528 12:46325920-46325942 TTACATACAGCTGAAGTGCAAGG - Intergenic
1095998778 12:48112107-48112129 TTACACACAGCCAAAGTGCAGGG - Intronic
1096907007 12:54945294-54945316 CTACACACAGCTGAAGTGCAGGG - Intergenic
1097444852 12:59658051-59658073 ACACAGACACCTGAAATACAAGG + Intronic
1097541956 12:60953966-60953988 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1097592565 12:61590382-61590404 TTACACACAGCCGCAGTGCAGGG + Intergenic
1098358658 12:69634378-69634400 CTAGACACATCTGAAAGACATGG - Intergenic
1098629793 12:72710876-72710898 TTATCCACAGCTGAAGTGCAAGG - Intergenic
1098920154 12:76295350-76295372 TTACACACAGCCAAAGTGCAGGG + Intergenic
1099172071 12:79376672-79376694 TCACACACATCTGACATAAATGG + Intronic
1099573370 12:84353945-84353967 TTAGGCACAGCTGAAATCAATGG + Intergenic
1099762828 12:86942533-86942555 TTACACACAGCTGAAGTGCAGGG + Intergenic
1100732239 12:97484559-97484581 TTTGACACAGTTGAAATAGATGG - Intergenic
1101603462 12:106230489-106230511 GCACACACATCTGAAATATATGG - Intergenic
1101692745 12:107096744-107096766 TTAACCACAGCTGGAACACAGGG - Intergenic
1102116516 12:110407261-110407283 TTACACACAGCCAAAGTACAGGG - Intergenic
1103928114 12:124434830-124434852 ATACACACAGAGCAAATACAAGG + Intronic
1104257881 12:127155692-127155714 TTACACACAGCTGAAGTGCAGGG + Intergenic
1105938100 13:25120479-25120501 TAAAACTCAGCTGAAATCCAAGG + Intergenic
1107001575 13:35552203-35552225 CTACAGACAACTGAAAGACAGGG + Intronic
1107050229 13:36039250-36039272 TTTCACACTTCAGAAATACATGG - Intronic
1107101783 13:36600859-36600881 TTACACACAGCAGAAAAAAGGGG + Intergenic
1107220059 13:37971154-37971176 TTACACACAGCCTAAGTGCAGGG - Intergenic
1108281815 13:48869095-48869117 TTACGCATAGCTGAAGTGCAGGG - Intergenic
1108599449 13:51979216-51979238 TTACACGGAGCTTGAATACAAGG + Intronic
1108696517 13:52907001-52907023 TTACACACAGATGAAAATCTGGG + Intergenic
1108795862 13:54029856-54029878 TCATGCACAGCTGAAATACAAGG - Intergenic
1108947672 13:56044038-56044060 TTACACACAGCTGAAGTGCAGGG + Intergenic
1109343836 13:61092256-61092278 TTACACACAGCCGAAGTGCAAGG + Intergenic
1109352148 13:61196745-61196767 TTACACACATGGGAAATACTGGG + Intergenic
1109491825 13:63111165-63111187 TTACCCCCAGTTGAAATTCAGGG - Intergenic
1110588209 13:77220636-77220658 TTACAGATAGTTGAAATAAAGGG - Intronic
1111566803 13:90027655-90027677 TTAGCCACAGCTGGAATGCATGG - Intergenic
1112237064 13:97646027-97646049 TTATACACAGCCGAAGTGCAGGG + Intergenic
1113071216 13:106423367-106423389 TTAATCAGAGCTCAAATACAGGG + Intergenic
1114221931 14:20704456-20704478 TTACACACAGCTGAAATACAAGG + Intergenic
1116179915 14:41519678-41519700 TTACACACAGCCGAAGTGCAGGG + Intergenic
1116702159 14:48257363-48257385 TTACACACAGCCAAAGTGCAGGG - Intergenic
1117486828 14:56205869-56205891 CTAAATACAGCTGAAATAAAAGG + Intronic
1117957674 14:61135401-61135423 TTACACACAGCTGAAGTGCAGGG - Intergenic
1118581534 14:67305117-67305139 TTATACACAGAAGAGATACAGGG - Intronic
1118937000 14:70297612-70297634 TTACACACAGCTGAAGTGCAGGG - Intergenic
1118989352 14:70783813-70783835 CTACACAGAGCTGAAAGACGTGG + Intronic
1119231282 14:72981785-72981807 TTACCCACAGCTGAGGCACAAGG + Exonic
1119560031 14:75582647-75582669 TAACACACAGCCAAAGTACAGGG - Intronic
1119909882 14:78339989-78340011 CTACCAACAGCTGAAATTCATGG + Intronic
1120126532 14:80750636-80750658 TTACACAAAGGTGAAAGACTGGG - Intronic
1120239058 14:81928300-81928322 TGACAAACAGGTGAAAAACAAGG + Intergenic
1120251155 14:82063067-82063089 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1120618474 14:86735051-86735073 TTACCCACAGCTGAAGTGCTGGG + Intergenic
1120659696 14:87236852-87236874 TTACACACAGCCGAAGTGCAGGG - Intergenic
1120799508 14:88672993-88673015 TTCCAAACAGCTGAAAAAAAGGG + Intronic
1121143861 14:91566443-91566465 TTTCTCACAGGAGAAATACAGGG + Intergenic
1121193027 14:92046532-92046554 TTACACACAGCTGAAATGCAGGG - Exonic
1121254703 14:92522748-92522770 TTACACCCAGCAAAAATTCAGGG - Intronic
1121389772 14:93564119-93564141 TTGCACACAGCCGAAGTGCAGGG - Intronic
1121703890 14:95976682-95976704 TTACGCACAGCCGAAGTGCAGGG + Intergenic
1121736297 14:96220432-96220454 TTACAAAAAGCAAAAATACAAGG + Intronic
1123628900 15:22247285-22247307 TTAGCCACAGCTGAGATGCAGGG - Intergenic
1124563400 15:30794915-30794937 TGAGTCACAGCAGAAATACAGGG - Intergenic
1124598195 15:31109076-31109098 ATAAACACATTTGAAATACAAGG + Intronic
1125054005 15:35336502-35336524 TGGCACACAGCTGAAAACCATGG - Intronic
1125212986 15:37238200-37238222 TTACACACAGCTGAAGTGCAGGG - Intergenic
1125629528 15:41135729-41135751 TTACACACAGCCGAAGTACAGGG + Intergenic
1126844009 15:52742478-52742500 TTACACACAGCCGAAGTGCAGGG + Intergenic
1128948438 15:71848959-71848981 TTCCACACAACTGAAACAGAAGG + Exonic
1129259665 15:74357658-74357680 TTACACACAGCTGAAGTGCAGGG + Intronic
1129662191 15:77559259-77559281 TTACAAACAACTGCAATACAGGG - Intergenic
1130781304 15:87043380-87043402 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1130945708 15:88549480-88549502 TTCCACACAGCTGAAGTGCAGGG - Intergenic
1131447974 15:92515234-92515256 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1131947970 15:97648795-97648817 ACACTCACATCTGAAATACAGGG - Intergenic
1132263254 15:100444022-100444044 TTACACACAGCTGAAGTGCAGGG + Intronic
1132796273 16:1724802-1724824 GTACAAAGAGCTGGAATACATGG - Intronic
1134430885 16:14205112-14205134 TTAAAGACAGAGGAAATACATGG + Intronic
1135025211 16:18994483-18994505 TTACACACAGCCAAAGTACAGGG - Intronic
1135827678 16:25744185-25744207 TTAAAATCAGCTGCAATACAAGG + Intronic
1136530194 16:30862949-30862971 TTACACACAGCTGAAGTGCAGGG + Intronic
1137011237 16:35322427-35322449 TTACACATTGCTGCAATAGAGGG - Intergenic
1137055107 16:35741841-35741863 TTACACACAGCCGAAGTGCAGGG - Intergenic
1137363674 16:47842297-47842319 TTACACACAGCCGAAGTGCAGGG + Intergenic
1138225868 16:55293709-55293731 TGAGACACAGATGAAACACAGGG + Intergenic
1139507764 16:67407804-67407826 TTGAAAACAGCTGAAATAAAAGG + Exonic
1140073954 16:71679142-71679164 TTACACACAACTTAAACAAATGG + Intronic
1140773746 16:78230326-78230348 ATGGACACAGCTGAAATACTAGG - Intronic
1141311261 16:82915502-82915524 TTAGCCTCTGCTGAAATACAGGG + Intronic
1142110837 16:88330296-88330318 GTACACACAGCAGAAATGCTAGG - Intergenic
1143414109 17:6733616-6733638 TTACACACAGCCAAAGTGCAGGG - Intergenic
1145080472 17:19890809-19890831 TTACACAACCCTGAAGTACAGGG - Intergenic
1146480035 17:33197702-33197724 TAAGACACAGCTAAAATAGAAGG + Intronic
1149220749 17:54413243-54413265 TTACACACAGCCGAAGTGCAGGG + Intergenic
1149253181 17:54793880-54793902 TGACACACAGCTTAGATCCAAGG + Intergenic
1150496116 17:65609068-65609090 TTACACAGAGGTGAAAAACGGGG - Intronic
1155962199 18:32003969-32003991 TTACACACAGCCAAAGTACAGGG + Intergenic
1156237598 18:35219498-35219520 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1156259991 18:35437391-35437413 GTAAACACAGTGGAAATACATGG - Intergenic
1156302493 18:35847652-35847674 TTACACACAGCTGAAGTGCAGGG + Intergenic
1156689774 18:39693605-39693627 TTAACAACAGCTGAAATAGAAGG - Intergenic
1156958428 18:42994610-42994632 TTACACACAGCCGAAGTGCAGGG + Intronic
1157986202 18:52440424-52440446 TTTCACACACCTGAAATAAATGG - Intronic
1158362795 18:56694727-56694749 TCAGACACAGCTGATAAACAGGG + Exonic
1158576564 18:58643668-58643690 TTACACACAGCTGAAGTGCAGGG - Intergenic
1159044963 18:63361107-63361129 TTACACACACCTGTAATCCCAGG + Intronic
1160338838 18:78068738-78068760 TAACACACAGCTTAAATAAAAGG - Intergenic
1161712391 19:5856317-5856339 TTACACACAGCCGAAGTGCTGGG + Intergenic
1162273933 19:9638369-9638391 TTATGTACGGCTGAAATACAAGG - Intronic
1162286931 19:9745706-9745728 TTATATACGGCTGAAATACAAGG + Intergenic
1163209929 19:15832708-15832730 TTACACACAGCTGAAACACAAGG + Intergenic
1163899946 19:20092432-20092454 TTACACACAGCCGAAGTGCAGGG - Intronic
1163944225 19:20521085-20521107 TTACATGCAGCCGAAGTACAGGG - Intergenic
1164202270 19:23028835-23028857 TTACACACAGCTGAAGTGCAGGG - Intergenic
1164259022 19:23553138-23553160 TTACACACAGCTGAAATACAAGG + Intronic
1166905511 19:46105877-46105899 TTACACACAGCTGAAGTACAGGG - Intergenic
1166926895 19:46275313-46275335 TTACACACAGCCGAAGTACAGGG - Intergenic
1167901371 19:52624628-52624650 CTACACACAGCCGAAGTGCAGGG + Intronic
1168248462 19:55126540-55126562 TCACACGCAGCTGAAGTACAGGG + Intergenic
925433588 2:3817708-3817730 TTACACACAGCCAAAGTGCAGGG - Intronic
926537108 2:14127004-14127026 TTAAATACAGCTTAAAAACATGG + Intergenic
926932547 2:18054897-18054919 TTAAACACAGTTGAAATGCATGG + Intronic
927247848 2:20972186-20972208 TTACAAACGGCTGAAGAACAAGG + Intergenic
928827422 2:35439078-35439100 TTACACACAGCCGAAGTGCAGGG - Intergenic
929004600 2:37382979-37383001 TTACCCACAGCTGAAGTGCAGGG - Intergenic
929383808 2:41381828-41381850 TTACACATAGCTGAAGTGCAGGG + Intergenic
929684293 2:44021021-44021043 TTACACACAGCCGAATTGCAGGG - Intergenic
930098801 2:47587459-47587481 TTACACACAGCAGAAGTGCAGGG - Intergenic
930487122 2:52024086-52024108 TTACCCACAGCCGAAGTGCAGGG - Intergenic
930489760 2:52053792-52053814 TTACGCACAAATGAAAGACAAGG + Intergenic
931090538 2:58881276-58881298 TTAAGTACAGCTTAAATACATGG + Intergenic
931096093 2:58942811-58942833 TTAGCCACAGCTGGAATGCAAGG - Intergenic
931948492 2:67335333-67335355 TTAGATACAGCTGAAGTGCAAGG + Intergenic
932159195 2:69445465-69445487 TTACACACAGCCAAAGTGCAGGG - Intergenic
932296080 2:70624344-70624366 TTACACACAGCCGAAGTGCAGGG + Intronic
932849509 2:75171197-75171219 TTAGCCACAGCTGGAACACAGGG - Intronic
932973713 2:76575828-76575850 TTACACACAGCCAAAGTGCAGGG - Intergenic
933072913 2:77883992-77884014 TTACACACAGGTCTAATATAAGG - Intergenic
933138178 2:78761637-78761659 TTATACACAGCCAAAGTACACGG + Intergenic
933516359 2:83308762-83308784 CTGCACACAGCTAAAATGCAAGG - Intergenic
934021048 2:87952749-87952771 TTACACAACGATGAAAAACAAGG - Intergenic
934141568 2:89052246-89052268 TTACACACAGCTGAAATACAAGG + Intergenic
934227675 2:90148297-90148319 TTACACACAGCTGAAATACAAGG - Intergenic
934514369 2:94976632-94976654 TTACACCCAGCAAACATACAGGG - Intergenic
937594737 2:123659922-123659944 TTACACACAGCTGAAGTGTAGGG - Intergenic
937603485 2:123768693-123768715 TCACACAGAGCTTAAATTCATGG + Intergenic
938659620 2:133472241-133472263 TTTCTCACAGTTGTAATACAAGG + Intronic
940107583 2:150116334-150116356 TTACCCACAGCTAAAGTGCAGGG + Intergenic
940175072 2:150869787-150869809 TAACTGACAGCTAAAATACATGG - Intergenic
940183197 2:150956794-150956816 TTACACACAGCCGAAGTGCAGGG + Intergenic
940183962 2:150962201-150962223 TTACACACAGCCCAAGTGCAGGG + Intergenic
940217072 2:151312569-151312591 TTACACACAGCTGAAGTGCAGGG + Intergenic
940236717 2:151519057-151519079 TAACACACAGGTTAAATACAAGG - Exonic
940731319 2:157396086-157396108 TTCAATACAACTGAAATACAGGG + Intergenic
941455933 2:165712313-165712335 TTACACACAGCCGAAGTGCAGGG - Intergenic
941935656 2:170979619-170979641 TTACACACGGCTGAAGTGCAGGG - Intergenic
942511445 2:176706893-176706915 CCACAGACATCTGAAATACAAGG - Intergenic
942730053 2:179053741-179053763 TTACACACAGCAGAAGTGCAGGG - Intergenic
943183913 2:184580422-184580444 TTACTAAAAACTGAAATACAGGG - Intergenic
943865576 2:192921791-192921813 TTACCCACAGCTGAAGTGCAGGG + Intergenic
943951062 2:194132865-194132887 TTACACACAGCTGAAGTGCAGGG - Intergenic
944049365 2:195449970-195449992 TGACACAGAGCTAAAATAAATGG - Intergenic
944960656 2:204869015-204869037 TTAGACACAGGTCAGATACAGGG - Intronic
945173715 2:207021138-207021160 TTACACACAGCTGAAGTGCAGGG + Intergenic
945301217 2:208218049-208218071 TTACACACAGCTGAAGTGCAGGG - Intergenic
945363808 2:208926419-208926441 TTACACACTACAGAAATATATGG + Intergenic
945554929 2:211265211-211265233 TTACACACAGCAAAAGTACAGGG + Intergenic
945858389 2:215093482-215093504 TTACACACAGCCGAAGTGCAGGG + Intronic
946376310 2:219311470-219311492 TTATACACTGGAGAAATACAGGG - Intergenic
946572577 2:221040966-221040988 TTACACAGAGCTGACAGATATGG + Intergenic
946780810 2:223191814-223191836 TTACACACAGCTGAAGTGCAGGG - Intronic
1168943045 20:1729722-1729744 TTACACACAGCCGAAGTACAGGG - Intergenic
1169062631 20:2672718-2672740 ATCCCCAAAGCTGAAATACATGG + Intergenic
1169989354 20:11483703-11483725 GTACACACACATGAAATCCAGGG - Intergenic
1170131886 20:13029733-13029755 TTACACTTAGTTGAAATATACGG - Intronic
1170325251 20:15149806-15149828 TTACACACAGCCGAAGTGCAGGG - Intronic
1172723512 20:37017409-37017431 TTACATACACCTGAAATACATGG + Intronic
1172932207 20:38594526-38594548 TTACACACAGCCGAAGTGCAAGG - Intergenic
1173273991 20:41562860-41562882 TTACACACAGCTGTAAAGCTTGG + Intronic
1174541998 20:51297056-51297078 ATACACACAAATGAAATAGAAGG + Intergenic
1174542003 20:51297135-51297157 ATACACACAAATGAAATAGAAGG + Intergenic
1176883739 21:14229656-14229678 TTAACCACAGCTGGAATGCAGGG - Intergenic
1177030935 21:15981779-15981801 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1177100883 21:16896061-16896083 TTACACACAGCCGAAGTGCAGGG + Intergenic
1177102912 21:16917723-16917745 TTACACACAGCCGAAGTGCAGGG + Intergenic
1177522066 21:22239043-22239065 TTACCCACAGCTGGGACACAGGG - Intergenic
1177779332 21:25606395-25606417 TTCCACACAGCTTAAGTAAAAGG + Intronic
1178867207 21:36338999-36339021 TTACACACAGTAGAAATACATGG + Intronic
1179650130 21:42803020-42803042 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1180168248 21:46041209-46041231 TTACTCACAGCTGATTTTCAAGG - Intergenic
1182484394 22:30630805-30630827 TTATACACTGGAGAAATACAGGG + Intergenic
1183635393 22:39059289-39059311 TTACACACAGCCAAAGTACAGGG - Intronic
950086653 3:10263324-10263346 TTTCCCACAGCTAAAGTACAAGG - Intronic
950268267 3:11591853-11591875 ACACACACAACTGACATACATGG + Intronic
951316080 3:21191176-21191198 TTACACACAGCCGAAGTGCAGGG - Intergenic
951762551 3:26162355-26162377 TTACACACAGCCGAACTGCAGGG - Intergenic
951894849 3:27600881-27600903 TTACATACAGCCAAAGTACAGGG + Intergenic
952022207 3:29036956-29036978 TAGGACACAGCTGAAATACTGGG - Intergenic
952297133 3:32071472-32071494 TTACACACAGCTGAAGTGCAGGG + Intronic
952792081 3:37207818-37207840 TTACACACAGCCAAAGTACAGGG + Intergenic
952894961 3:38072480-38072502 TTACACACAGCCGAAGTGCAGGG - Intronic
953599170 3:44346841-44346863 TTACACACAGCCGAAGTACAGGG - Intronic
953656300 3:44857495-44857517 TTACACACAGCCAAAGTGCAGGG - Intronic
953834226 3:46329319-46329341 TTACACACAGCCAAAGTACAAGG - Intergenic
953840902 3:46389585-46389607 TTACACACAGCTGAAATACAAGG - Intergenic
954112683 3:48443912-48443934 TTAAATACAGATGAAATAAAGGG - Exonic
954161524 3:48726298-48726320 TTACACACAGCTGAAGTGCAGGG - Intronic
955253612 3:57307397-57307419 TTACCCACAGCCCAAATACGGGG + Intronic
955690641 3:61587053-61587075 TTACTCACAGCAGAAATTAAGGG + Intronic
955751622 3:62189725-62189747 CTACACTCAGCTGAAGTTCAGGG + Intronic
956162588 3:66370900-66370922 TTACACAGTGCAGAAATACAAGG + Intronic
956233268 3:67040670-67040692 TTACACACAGCTGAAGTGCAGGG - Intergenic
956548759 3:70436841-70436863 TTACACACAGCTGAAGTGCAGGG - Intergenic
956625722 3:71264717-71264739 TTACCTCCAGCTGAACTACAGGG - Intronic
956709453 3:72026721-72026743 TTACACACAGCCGAAGTGCAGGG + Intergenic
956984077 3:74676458-74676480 TTACATACATCTGAAATACATGG + Intergenic
957065678 3:75519988-75520010 TTCCTCACTGGTGAAATACAGGG - Intergenic
957451673 3:80388613-80388635 TTACACACAGCCAAAGTACAGGG + Intergenic
957675068 3:83355502-83355524 TTACATACAGCTGAAGTGCAGGG - Intergenic
957904595 3:86540196-86540218 TTACACACAGCCAAAGTGCAGGG - Intergenic
957985949 3:87573218-87573240 TTACACACAGCCAAAGTGCAGGG + Intergenic
958422198 3:93941645-93941667 TTACACACAGCCAAAGTGCAGGG + Intronic
958642027 3:96815809-96815831 TTATGCACAGCAGAAATACAAGG - Intronic
958751240 3:98194825-98194847 TTACACACAGCCAAAATGCAGGG + Intronic
958802345 3:98770692-98770714 CTACACACACCTGAGATTCATGG - Intronic
959206947 3:103320600-103320622 TTAAATACAGCTGAACTTCATGG - Intergenic
959965172 3:112345917-112345939 TGACACACAGCTGAGATGAAAGG + Intronic
960099868 3:113729927-113729949 TTACACACACTTTAAATATAAGG - Intronic
960507070 3:118506704-118506726 AAACACTAAGCTGAAATACATGG - Intergenic
961712513 3:128838525-128838547 TTACACACAGCCGAAGTGCAGGG - Intergenic
962021989 3:131511360-131511382 TTACACACAGCCAAAGTTCAGGG - Intergenic
962523719 3:136219918-136219940 TTACACACAGCCGAAGTACAGGG - Intergenic
962660873 3:137599208-137599230 TTACACACAGCTGAAGTGCAGGG + Intergenic
963080387 3:141387083-141387105 ATACTCACATCTGAAATACTAGG - Intronic
963320000 3:143801184-143801206 TTACACACAGCTGAAGTGCAGGG + Intronic
963521859 3:146365787-146365809 TTACACACAGCCGAAGTGCAGGG + Intergenic
964300020 3:155277161-155277183 TTACACACAGCTGAAGTGCAGGG - Intergenic
964300998 3:155284795-155284817 TTACACACAGCTGAAATACAAGG - Intergenic
964562955 3:158018649-158018671 TAACATTCAGCTGAAAGACATGG - Intergenic
964940724 3:162156114-162156136 TTACACACAGCCAAAGTGCAGGG - Intergenic
965070557 3:163911267-163911289 TTACACACAGCCGAAGTGCAGGG + Intergenic
965152437 3:164996082-164996104 TTAGAAAATGCTGAAATACAAGG - Intronic
965262414 3:166502760-166502782 TTACACACAGCCGAAGGGCAGGG - Intergenic
965335848 3:167430245-167430267 TTACTCACTGCTGAAAAAGAAGG + Intergenic
965336570 3:167434949-167434971 TTACACACAGCCGAAGTGAAGGG + Intergenic
965624625 3:170674342-170674364 TTACACACAGCCAAAGTGCAGGG - Intronic
965639774 3:170819775-170819797 TTACACACAGCCGAAGTGAAGGG - Intronic
966067065 3:175831407-175831429 TTACACACAGCTGAAGTGCAGGG + Intergenic
966085669 3:176065067-176065089 TTACACACAGCTGAAGTGCAGGG + Intergenic
967005109 3:185376513-185376535 TTACATACAGCCGAAGTGCAGGG - Intronic
967509440 3:190292355-190292377 TTAGCCACAGCTGGAATGCATGG + Intergenic
967624418 3:191668465-191668487 TTACACACAGCCGAAGTGCAGGG - Intergenic
968413011 4:405556-405578 TTACACACAGCCAAACTGCAGGG - Intergenic
969653818 4:8484598-8484620 TTACACACAGCTGAAGTGCAGGG - Intronic
969791162 4:9494714-9494736 TGACACACAGCTAACACACATGG + Intergenic
970028989 4:11655722-11655744 TTACACACAGCTGAAGTGCAGGG - Intergenic
970087782 4:12367497-12367519 TTACACACAGCTGAAGTGCAGGG + Intergenic
970551313 4:17184604-17184626 ACACACAGAGCTGAAATCCAGGG + Intergenic
972624330 4:40781365-40781387 TTAAACACATTTAAAATACATGG + Intronic
973719687 4:53710948-53710970 TTGCTCCCAGGTGAAATACAGGG - Intronic
973751313 4:54023164-54023186 TTACACACAGCCAAAGTACTGGG + Intronic
974171341 4:58270640-58270662 TTAGCCACAGCTGGAACACAGGG - Intergenic
974173197 4:58293291-58293313 TTACACACAGCCAAAGTACAGGG - Intergenic
974557092 4:63464963-63464985 TTAGACACAGCTGGGATGCAGGG + Intergenic
974904035 4:68034504-68034526 TTACACACAGTGGAAGTGCAGGG + Intergenic
975005144 4:69274477-69274499 TTAGCCACAGCTGAGACACAGGG - Intergenic
975152321 4:71034889-71034911 TTACACACAGCTGAAGTGCAGGG + Intergenic
976719363 4:88155018-88155040 TTACACACAGCCGAAGTGCAGGG - Intronic
976739700 4:88345575-88345597 TTACACACAGCCAAAGTACAGGG - Intergenic
977782198 4:100993761-100993783 TTACACACAGCCAAAGTGCAGGG - Intergenic
977809356 4:101341718-101341740 TTACAGAAAGCTGAAGTTCAAGG + Intronic
978031718 4:103944867-103944889 TTACCCACAGCTGAAGTGCAGGG + Intergenic
978303025 4:107292564-107292586 TTACACACAGCCAAAGTACAGGG - Intergenic
978649919 4:110989604-110989626 TTACACACAGTTGTAATAACTGG - Intergenic
978764411 4:112389753-112389775 TTACAGACATCTGAAACTCATGG + Intronic
978914444 4:114106522-114106544 TACCACACAGAGGAAATACAGGG + Intergenic
979171171 4:117602294-117602316 TTACCCACAGCTGAAATGCAGGG - Intergenic
979839549 4:125421331-125421353 TTTCACATAGCTTAAATATAAGG + Intronic
980235568 4:130100726-130100748 TTGCACACAGTTTAAATATATGG - Intergenic
980285177 4:130771094-130771116 TTACACACAGCTGAAGTGCAGGG + Intergenic
980472204 4:133265681-133265703 TTACCCACAGCCGAAGTGCAGGG - Intergenic
980491169 4:133531544-133531566 TTACACACAGCCAAAGTACAAGG - Intergenic
981822856 4:148905626-148905648 TTAGATATAGCTGAAATATAGGG + Intergenic
982413966 4:155110461-155110483 TTACACACAGCCAAAGTGCAGGG - Intergenic
983056375 4:163102758-163102780 TTACACACAGCGGAAGTGCAGGG - Intergenic
983138620 4:164120112-164120134 TCACACAAAGCTGAAAATCAAGG + Intronic
983345792 4:166524256-166524278 TTACACACAGCCGAAGTGCAGGG + Intergenic
983448261 4:167879842-167879864 TTACACACAGCTGAAGTGCAGGG + Intergenic
983707903 4:170681218-170681240 TTACACACAGCTGAAGTGCAGGG + Intergenic
984098810 4:175463376-175463398 TTACACACAGCCGAAGTGCAGGG - Intergenic
984423991 4:179560056-179560078 TTACACAACGATGAAAAACAAGG + Intergenic
984436317 4:179714430-179714452 TGACACACAAGAGAAATACAAGG - Intergenic
984437499 4:179724177-179724199 TTACCCACAGCTGAAGTGCAGGG + Intergenic
985078769 4:186244094-186244116 TTACACACAGCCGAAGTGCAGGG - Intronic
985127220 4:186706711-186706733 TTCCACAAAGCTGGAAAACACGG + Exonic
985235726 4:187871872-187871894 TTGCACAAGGCTGAAAAACAAGG + Intergenic
985435946 4:189929585-189929607 TTACACACAGCTGAAGTGCAGGG + Intergenic
986186629 5:5447528-5447550 ATACACACACCTTAAATACGTGG + Intronic
986368717 5:7060127-7060149 TTACACACAGCTGAAGTGCAGGG - Intergenic
987291220 5:16510309-16510331 AGACACACAACTGAAATACCAGG + Intronic
988054729 5:26079809-26079831 TTATACACTGCTAAAATACAAGG - Intergenic
988199335 5:28049373-28049395 TTACACACAGCCAAAGTGCAGGG + Intergenic
989614912 5:43329754-43329776 TTACACACAGTCGAAGTGCAGGG - Intergenic
989775740 5:45205321-45205343 TTTCACAATGCTGAAATAAAAGG + Intergenic
990065158 5:51703410-51703432 TTACATACAACTGTAATAAATGG + Intergenic
990564935 5:57019341-57019363 TTACACACAGCCGAAGTGCAGGG - Intergenic
992122920 5:73612760-73612782 TTACTCAAATCTGAAATACTGGG + Intergenic
992451755 5:76882361-76882383 TTACACACAGCCAAAGTGCAGGG - Intronic
992961069 5:81957014-81957036 TTACACACAGCCAAAGTGCAGGG + Intergenic
993702363 5:91133452-91133474 CTACTCACTGCTGAAATAGAAGG + Intronic
993985775 5:94595416-94595438 TTAGCCACAGCTGGCATACAGGG + Intronic
994325144 5:98438456-98438478 TTACACACAGCCAAAGTACAGGG + Intergenic
994375540 5:99013301-99013323 TTACACACAGCCAAAGTACAGGG - Intergenic
994876812 5:105433992-105434014 TTACAGACTGCTGAAATAGCTGG - Intergenic
995769578 5:115653898-115653920 TTACACACAGCCGAAGTACAGGG + Intergenic
995885490 5:116889634-116889656 TTACAGAAAGCTGCAAGACAAGG - Intergenic
995988664 5:118209755-118209777 TTAACCACAGCTGGGATACAGGG - Intergenic
996052377 5:118948709-118948731 TTACACACAGCCGAAGTGCAGGG - Intronic
996725675 5:126671935-126671957 TTACACACAGCCAAAGTGCAGGG - Intergenic
996745200 5:126841533-126841555 TTACACACAGCCGAAGTGCAGGG - Intergenic
996917867 5:128732864-128732886 TTACACACAGCCAAAGTGCAGGG + Intronic
997157563 5:131575756-131575778 TTACATATGGCTGAAAAACAAGG + Intronic
997482758 5:134200682-134200704 TGAGACACAGCTGACATCCATGG + Intronic
997549018 5:134736275-134736297 TTACACACAACTGAAAATAATGG - Intergenic
997678604 5:135733715-135733737 TTACACACAGCCGAAGTGCAGGG - Intergenic
997756434 5:136403948-136403970 ATCAACACAGCTGAAATACGTGG - Intergenic
998633436 5:143926270-143926292 TTACACACAGCCGAAGTGCAGGG + Intergenic
999865810 5:155699370-155699392 TTACCCACAGCCAGAATACATGG + Intergenic
1000439949 5:161252225-161252247 TTACCCACAGCCGAAGTGCAAGG + Intergenic
1001354040 5:171003205-171003227 TTACATACAGCTGAATTGCAGGG - Intronic
1001558904 5:172656467-172656489 TTAAATACAGATGAAATAAAGGG + Intronic
1003100003 6:3169760-3169782 TTACACACAGCCTAAGTGCAGGG + Intergenic
1003256805 6:4482379-4482401 TTACACAAAGCTGAATTAAAAGG - Intergenic
1003512472 6:6792836-6792858 TGACACACAATGGAAATACAAGG + Intergenic
1004008047 6:11654912-11654934 TTACACACAGCTGATTTATAAGG + Intergenic
1004837239 6:19542634-19542656 TTACACACAGCTGAAGTGCAGGG + Intergenic
1006325035 6:33347178-33347200 TTACACACAGCCGAAGTGCAGGG + Intergenic
1007044925 6:38763480-38763502 ATACACATAGCTGTGATACAAGG + Intronic
1007300732 6:40866088-40866110 TTACACACAGCCGAAGTGCAGGG - Intergenic
1008476826 6:51942233-51942255 TTACCCACAGCTGAAGTGCAGGG + Intronic
1008914712 6:56774690-56774712 TTATACAAAGAAGAAATACAAGG + Intronic
1009464588 6:63953773-63953795 TTACACACAGCTGAAATACAGGG + Intronic
1009750007 6:67870552-67870574 TTACACCCAGCCAAAGTACAGGG - Intergenic
1010071486 6:71750533-71750555 TTACCCACAGCTGAAGTGCAGGG - Intergenic
1011327704 6:86168504-86168526 TAAGAGACAACTGAAATACATGG - Intergenic
1011812878 6:91153380-91153402 TTTCACAGAAATGAAATACATGG + Intergenic
1012478604 6:99642204-99642226 TTAAACCCACCTGAAACACAAGG - Intergenic
1013183343 6:107736399-107736421 TTACAGACAGCAGAAAAACTTGG + Intronic
1013807846 6:114014308-114014330 TTACACACAGCCAAACTGCAGGG - Intergenic
1014115089 6:117661532-117661554 TTACACACAGCCGAAGTGCAGGG - Intergenic
1015165441 6:130196050-130196072 TTACACACAGCTGAAGTGCAGGG + Intronic
1017645423 6:156535502-156535524 ATAAACACAGCTCAAATACGAGG - Intergenic
1017922625 6:158885381-158885403 TTACACACAGCCAAAGTACAGGG - Intronic
1017968097 6:159284375-159284397 TGGTTCACAGCTGAAATACAAGG + Intergenic
1018043085 6:159942227-159942249 TCACACATACCTGTAATACAAGG + Intergenic
1018077797 6:160231860-160231882 TTACATACAGCTGAAGTGCAGGG + Intronic
1018135953 6:160778611-160778633 TTACACACAGCCAAAGTGCAGGG + Intergenic
1018420891 6:163640531-163640553 TTTCATGCAGCTGAAATGCATGG + Intergenic
1018617370 6:165700440-165700462 TTTCACACAGGCGAATTACATGG + Intronic
1019565777 7:1678380-1678402 TTACCCACAACTGACATGCAGGG - Intergenic
1020364175 7:7362268-7362290 TTGCATACAGCTGGAATCCAAGG - Intronic
1020540903 7:9460529-9460551 TTACACACAGCTGAAATGCAGGG - Intergenic
1020794460 7:12663431-12663453 TTGCACACAGCTAAAGTGCAGGG + Intergenic
1020800422 7:12725994-12726016 TCCCACACAGCTGAAATAAATGG + Intergenic
1021393853 7:20124322-20124344 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1021637584 7:22707137-22707159 TTACACACAGCCGAAGTGCAGGG + Intergenic
1021773035 7:24024198-24024220 TTACACACACAAAAAATACAGGG + Intergenic
1022447643 7:30482965-30482987 TTACACACAGCCGAAGTGCAGGG + Intergenic
1022671131 7:32457370-32457392 CTGCACACTGCTCAAATACAGGG - Intergenic
1022709311 7:32836092-32836114 TTACACACTGCTGAAGTGCAGGG + Intergenic
1023556144 7:41424773-41424795 GATCACACAGCTGAAATTCAAGG + Intergenic
1024738990 7:52335460-52335482 TTACACACAGCCAAAGTGCAGGG - Intergenic
1024927489 7:54632827-54632849 TTTCACAAAGCTGAAATCCAGGG + Intergenic
1025589830 7:62843686-62843708 TTCCAAACTGCTGAAATAAAAGG - Intergenic
1025680464 7:63677976-63677998 ACACACACAACTGAAATACCAGG + Intergenic
1026363450 7:69624556-69624578 TTGCACACAGCTTAAGTGCAGGG - Intronic
1026382357 7:69812364-69812386 TTCCATACAGCACAAATACAAGG + Intronic
1027158577 7:75785820-75785842 TTACACACAGCCAAAGTGCAGGG + Intronic
1027354608 7:77343046-77343068 TTACACACAGCCAAAGTGCAGGG + Intronic
1028368407 7:90062065-90062087 TTTCACACAGCTGTGATAAAAGG + Intergenic
1028589640 7:92481598-92481620 TTACACACAGCCGAAGTGCAGGG - Intergenic
1029308868 7:99642763-99642785 TTTCACACAGCTGAAGTTCCAGG - Intergenic
1029317431 7:99727161-99727183 TTACACACAGCCAAAGTGCAGGG + Intronic
1029500447 7:100925888-100925910 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1030163376 7:106530415-106530437 TTACACACAGCCAAAGTGCAGGG - Intergenic
1030193754 7:106833525-106833547 TTACACACGGCTGAAATAAAAGG + Intergenic
1030441457 7:109594014-109594036 TTACACACAGCCGAAGTGCTGGG - Intergenic
1030445605 7:109644522-109644544 TTACACAAAGCTGAAGTGCAGGG - Intergenic
1031296846 7:120012610-120012632 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1031422211 7:121565803-121565825 TTACACACAGCTGAAGTGCAGGG - Intergenic
1031704370 7:124962615-124962637 TTACACACAGCTGAAGTGCAGGG - Intergenic
1031756931 7:125656855-125656877 TTTCCCACAGCTGAAGCACAGGG + Intergenic
1031777571 7:125921302-125921324 TTACACACAGCCAAAGTGCAGGG + Intergenic
1033464806 7:141580808-141580830 TTACATACAGCTGAAGTGCAGGG - Intronic
1033625766 7:143108178-143108200 TTACACACAGCCAAAGTACAGGG + Intergenic
1033661612 7:143406967-143406989 TTTCAAACAGCTGGAATGCATGG + Intronic
1034334402 7:150311241-150311263 GTCCACACAGCTGAAATACAAGG + Intronic
1034456326 7:151172960-151172982 TTTAACACAACAGAAATACAGGG - Intronic
1034628604 7:152513383-152513405 TCACACCCAGCTGAAACTCAAGG + Intergenic
1035675369 8:1452119-1452141 TGACAGACAGCTGGAAGACACGG - Intergenic
1036639742 8:10575162-10575184 TTACATACAGGTGAAGTGCAGGG + Intergenic
1036718833 8:11153568-11153590 TTTCAAATATCTGAAATACAAGG + Intronic
1039368086 8:36953813-36953835 TGAGACACAGCTTAAATATATGG + Intergenic
1039710613 8:40052485-40052507 TTACTCACAGCTAAAACATATGG - Intergenic
1041633940 8:60121268-60121290 TCACAGACAGCAAAAATACATGG + Intergenic
1041651608 8:60308475-60308497 TTACACACAGCCGAAGTGCAGGG - Intergenic
1041874284 8:62669808-62669830 TTACAAACAGCTGCATGACAAGG + Intronic
1041917295 8:63150304-63150326 TTACACACAGCCAAAGTGCAGGG - Intergenic
1042706317 8:71668044-71668066 TTACACACAGCCAAAGTGCAGGG + Intergenic
1043212636 8:77543186-77543208 AAACACTCAACTGAAATACAAGG - Intergenic
1043323708 8:79023812-79023834 ACACACAGAGCTGAAATTCAAGG - Intergenic
1043547873 8:81335518-81335540 TGACAGAGAGCTGAAAAACATGG + Intergenic
1043597221 8:81900510-81900532 TTACACACAGCCAAAGTACAGGG - Intergenic
1043599085 8:81917178-81917200 TTACACACACCTGAAGTGCAGGG + Intergenic
1044055909 8:87569615-87569637 TTAGCCACAGCTGAGATGCAGGG - Intronic
1044517811 8:93159551-93159573 TTATCCACAGCTGAATTACTTGG - Intronic
1045952480 8:107866948-107866970 TTGCACAGTGCTGAGATACATGG - Intergenic
1046075096 8:109304155-109304177 TTACACACAGCTGAAGTGCAGGG + Intronic
1046880222 8:119299334-119299356 TTAGACACAGCTGGGATATAGGG + Intergenic
1047856606 8:128918140-128918162 TTACACACAGCTGAAGTGCAGGG + Intergenic
1048135693 8:131744452-131744474 TTACACACAGCCAAAGTGCAGGG + Intergenic
1048143996 8:131822919-131822941 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1048450612 8:134530115-134530137 TTTAACACAGCTGATACACAAGG + Intronic
1048481562 8:134800559-134800581 CTACACTCAGCTGTAATACATGG - Intergenic
1048728188 8:137410258-137410280 TTACACACAGCTGAAGTGCAGGG - Intergenic
1048764008 8:137826801-137826823 TTACACACAGCCGAAGTGCAGGG - Intergenic
1049868564 8:144956077-144956099 TTACACACAGCCGAAGTGCAGGG - Intergenic
1050117849 9:2279291-2279313 TTACACACAGCTGAAGTGCAGGG + Intergenic
1050140740 9:2513336-2513358 TTACACACAGCTGAAATACAAGG + Intergenic
1050257856 9:3813148-3813170 TTACACACAGCTGAAGTGCAGGG - Intergenic
1050268180 9:3913400-3913422 TTACCTACAGCTCAAATTCATGG + Intronic
1050782617 9:9356847-9356869 TTATACAAAGCAGAAATTCAGGG - Intronic
1050951817 9:11606305-11606327 TTACATTCACCTGAAATGCAAGG - Intergenic
1051179625 9:14396569-14396591 TTACACACAAATGTAATATAAGG - Intronic
1052163312 9:25291409-25291431 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1052720413 9:32166528-32166550 TTACCCACAACTGAAGTGCAGGG - Intergenic
1053058257 9:35007214-35007236 TTACCCACAGCTGAAGTGCAGGG + Intergenic
1053059735 9:35021695-35021717 TTACACATAGCTGAAGTGCAGGG - Intergenic
1053078284 9:35153494-35153516 TTACACACAGCCGAAGTGCAGGG - Intergenic
1053428565 9:38027053-38027075 CTACACATAGCTGCAATTCAGGG - Intronic
1053549911 9:39066746-39066768 TTACACAGAGAAGAAAAACAAGG - Intergenic
1054807247 9:69406732-69406754 TTACACACAGCTGAAGTGCAGGG - Intergenic
1055212967 9:73820780-73820802 TTACACACAGCTTAAAGATGCGG + Intergenic
1055626963 9:78184540-78184562 TTACACACAGCTGAAGCACAGGG + Intergenic
1056363940 9:85884426-85884448 TTACACACAGCTGAAGTGCAGGG + Intergenic
1056982755 9:91331421-91331443 TTAGATACACTTGAAATACAAGG - Intronic
1057812346 9:98267798-98267820 TTACCCACAGCTGGAGTGCAGGG - Intergenic
1058612632 9:106792074-106792096 TTACACACAGCCGAAGTGCAAGG + Intergenic
1058740325 9:107936394-107936416 TTACACAAAGCTTGAATACCAGG - Intergenic
1059863254 9:118487652-118487674 TTACACACAGCCGAAGTGCAGGG - Intergenic
1060737637 9:126076606-126076628 TTACACACAGCCAAAGTGCAGGG - Intergenic
1062110469 9:134779485-134779507 TAACACGGAGTTGAAATACATGG + Intronic
1062692222 9:137848012-137848034 TTACACATGGCTGAAGTGCAGGG + Intronic
1187773717 X:22731029-22731051 TTACAGCCAAGTGAAATACAGGG - Intergenic
1188200689 X:27290953-27290975 TTACACACAACCGAAGTGCAGGG - Intergenic
1188300840 X:28504533-28504555 TTACACACAGCTGAAGTGCAGGG - Intergenic
1188419735 X:29979058-29979080 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1188431264 X:30107074-30107096 TTACACACAGCTGAAGTGCAGGG + Intergenic
1188463153 X:30451097-30451119 TTACACACAGCCAAAGTGCAAGG - Intergenic
1188552896 X:31381231-31381253 TTACACACCGCTGAAGTGCAGGG + Intronic
1189751690 X:44229006-44229028 TTCCAAACAGCAGAAACACAGGG - Intronic
1190974513 X:55386508-55386530 TTAGCCACAGCTGAGACACAGGG - Intergenic
1191013999 X:55790681-55790703 TTACACACAGCCAAAGTACAGGG - Intergenic
1191761544 X:64652795-64652817 TTACACACAGCCAAAGTGCAGGG + Intergenic
1191762050 X:64656631-64656653 TTACTCACTGCTGAAAAACAAGG + Intergenic
1191825812 X:65363628-65363650 TTACACACAGCTGAAGTGCAGGG + Intergenic
1192731264 X:73804717-73804739 TTACACACAGCTGAAGTGCAGGG - Intergenic
1192764270 X:74126303-74126325 TTACATATAGCTGAAATACAAGG - Intergenic
1192913879 X:75634109-75634131 TTACACAAAGCCGAAGTGCAGGG - Intergenic
1193537317 X:82730568-82730590 TTACACACAGCCAAAGAACAGGG + Intergenic
1194408161 X:93523948-93523970 TTATACAGATCTCAAATACATGG - Intergenic
1194660918 X:96627760-96627782 TTACACACAGCTGAAGTGCAGGG + Intergenic
1194885287 X:99307832-99307854 TGACACACAGCTGCTGTACAGGG - Intergenic
1195117854 X:101717830-101717852 TGACACACAGCTAAAATCCTTGG + Intergenic
1195326621 X:103763759-103763781 TTACACACAGCCGAAGTGCAGGG - Intergenic
1195486505 X:105414091-105414113 TTACACAGTGCTGATATAGAAGG + Intronic
1195890052 X:109683805-109683827 TTACAGAAAGCTGAAATAACTGG + Intronic
1196091208 X:111745361-111745383 GAAAACACAGCTGAAATTCAAGG - Intronic
1196300234 X:114043713-114043735 TTACACACAGCTGAAGTGCAAGG + Intergenic
1196992440 X:121344979-121345001 TTACACACAGCCGAAGTGCAGGG - Intergenic
1197297677 X:124738925-124738947 TTACAGAGATCTGCAATACAGGG - Intronic
1197471203 X:126866806-126866828 TTACCCACAGCCGAAGTGCAGGG + Intergenic
1197499946 X:127230321-127230343 TTATCCACAGCTGAAGTGCAGGG + Intergenic
1197578812 X:128256215-128256237 TTAGTCACAGCTGGGATACAGGG + Intergenic
1198983524 X:142425550-142425572 TTACCCACAGCCGAAGTGCAGGG - Intergenic
1199051512 X:143242104-143242126 TTAGCCACAGCTGGAATGCAGGG + Intergenic
1200007545 X:153097818-153097840 TTACACACAGCTGAAATACAAGG - Intergenic
1200283672 X:154800529-154800551 TTCCACACAGCAGAAACACAGGG + Intronic
1201937381 Y:19422863-19422885 TTACACACAGCCAAAGTGCAGGG + Intergenic
1202076282 Y:21040903-21040925 TTACACACAGCTGAAGTGCAGGG - Intergenic