ID: 1114223787 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:20720502-20720524 |
| Sequence | CGGTACACACAGTTGGGCAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114223787_1114223794 | 21 | Left | 1114223787 | 14:20720502-20720524 | CCAATGCCCAACTGTGTGTACCG | No data | ||
| Right | 1114223794 | 14:20720546-20720568 | GGTATCACAACTTTTTAGTCTGG | No data | ||||
| 1114223787_1114223793 | 0 | Left | 1114223787 | 14:20720502-20720524 | CCAATGCCCAACTGTGTGTACCG | No data | ||
| Right | 1114223793 | 14:20720525-20720547 | CCTGAAGGAAAATGTTTCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114223787 | Original CRISPR | CGGTACACACAGTTGGGCAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||