ID: 1114223787

View in Genome Browser
Species Human (GRCh38)
Location 14:20720502-20720524
Sequence CGGTACACACAGTTGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114223787_1114223794 21 Left 1114223787 14:20720502-20720524 CCAATGCCCAACTGTGTGTACCG No data
Right 1114223794 14:20720546-20720568 GGTATCACAACTTTTTAGTCTGG No data
1114223787_1114223793 0 Left 1114223787 14:20720502-20720524 CCAATGCCCAACTGTGTGTACCG No data
Right 1114223793 14:20720525-20720547 CCTGAAGGAAAATGTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114223787 Original CRISPR CGGTACACACAGTTGGGCAT TGG (reversed) Intergenic
No off target data available for this crispr